who is it to be blamed for the problems in the Philippines?

Answers

Answer 1

Answer:

Nature

Explanation:

What are the major problems in the Philippines?

The Philippines are prone to natural disasters, particularly typhoons, floods, landslides, volcanic eruptions, earthquakes, and tsunamis, lying as it does astride the typhoon belt, in the active volcanic region known as the “Pacific Ring of Fire,” and in the geologically unstable region between the Pacific and Eurasian ...

Hoped that helped:)


Related Questions

I've been asked to write an essay on civil rights and to choose one that personally affects my life today and I need to get a quote from somebody. It says from friends or family, but I can say you guys are my friends, right? Yeah.
So, can someone give me their opinion on LGBTQIA rights? (Nothing negative, please!)

Answers

Answer:

Hope this helps...

Explanation:

People belonging to the LGBTQIA community often have their basic civil rights ignored and are often discriminated against simply because they do not love people of the "appropriate gender". Personally, I believe this is equivalent to racism and everyone, regardless of their sexuality, should be allowed their rights. It is unfair and immoral to ignore the rights of others. Everyone should have the right to love who they choose and the freedom to speak about it without having to face discrimination.

Answer:    

My opinion on LGBTQ rights is.  Everyone has their own right to express themselves with how they feel, right? So why should people make such a big deal if people of the LGBTQ community want to express themselves?

Some of the most important people in my life have been part of the LGBTQ community and seeing the way that they have expressed themselves and how happy it made them to do so, made me realize it should not matter what you think or how it makes you feel just so long as they feel welcomed and loved and what they are doing makes them happy.

As a result of the treaty of vessels Germany lost land which two countries?

Answers

Answer:

On its eastern frontier Germany was forced to cede to the newly independent Poland the province of West Prussia, thereby granting Poland access to the Baltic Sea, while Germany lost land access to the province of East Prussia. Danzig was declared a free city under the permanent governance of the League of Nations.

Explanation:

found on the continental divide, what was the halfway mark of the trail?

Answers

The place that was found on the continental divide and was considered the halfway mark of the trial was the South Pass.

On the Oregon Trail, there would be a point where travelers would reach the Continental divide which was the frontier of Oregon country. This was considered the halfway point in the trail.

This point was known as the South Pass and it is a mountain pass that is located in the state of Wyoming.

In conclusion, the point being talked about is the South Pass.

Find out more about the Oregon Trail at https://brainly.com/question/10941327.

I don’t know the answer

Answers

Answer:

what's the question

Explanation:

I don't see anything attached

Answer:

aaaa

Explanation:

brother

what's your questions

I didn't understand what it meant.

sorrry

2. Carl tries to entertain his guests with a movie and everyone cheers
and feels the enjoyment as well. What type of context clue helps the
reader understand the meaning of the word entertain?
A antonym B. contrast C. definition D. exemplification

Answers

D. Exemplification. It doesn't contrast anything to it, doesn't give it an opposite word, and doesn't say what it means plainly. So from process of elimination, it is D.

Which political faction was most upset when the United States and Britain split territory in Oregon at the forty-ninth parallel

Answers

Answer:

northern Democrats.

Explanation

The Northern Democratic Party was a leg of the Democratic Party during the 1860 presidential election, when the party split in two factions because of disagreements over slavery. They held two conventions before the election, in Charleston and Baltimore, where they established their platform.[1] Democratic Candidate Stephen A. Douglas was the nominee and lost to Republican Candidate Abraham Lincoln, whose victory prompted the secession of 11 Southern states and the formation of the Confederate States of America.

Answer:

northern Democrats

Explanation:

[tex]\huge\color{red}{{{x}}}[/tex][tex]\huge\color{cyan}{{{x}}}[/tex][tex]\huge\color{orange}{{{a}}}[/tex][tex]\huge\color{green}{{{o}}}[/tex][tex]\huge\color{purple}{{{i}}}[/tex][tex]\huge\color{blue}{{{x}}}\huge\color{red}{{{x}}}[/tex]

What ocean blows cold air to cill northern and central Canada

Answers

The answer is the
Atlantic Ocean

Answer:

The atlantic ocean

Explanation:

Why and how the Spanish were able to easily defeat the Aztecs?

Answers

Answers: The Spanish were able to defeat the Aztec and the Inca not only because they had horses, dogs, guns, and swords, but also because they brought with them germs that made many native Americans sick. Diseases like smallpox and measles were unknown among the natives; therefore, they had no immunity to them.

explain how political parties connect citizens to their government and provide examp real or made up.​

Answers

Answer:

The United States is a representative democracy. This means that our government is elected by citizens. Here, citizens vote for their government officials. Voting in an election and contacting our elected officials are two ways that Americans can participate in their democracy.

Can you give me brainliest :>

Explanation:

Can someone plz help me? :(

Answers

Answer:

i think it's B

Explanation:

According to the Constitution, at what age may a candidate run for the office
of president of the United States?
O 25
O 30
O 35
O no age requirement

Answers

It is 35 years of age

Answer: 35

Explanation: Edmentum, got it right!

Which was part of the Columbian Exchange?
A. Potatoes and tomatoes were introduced in Europe.
B. Horses and cattle went from the Americas to Africa.
C. People from Asia traveled to the Americas.
D. Millions of Europeans died of a plague.

Answers

Answer:

B. horses and cattle went from the Americas to Africa.

Explanation:

Answer: B

Explanation: i had read the book.

4) Why are the Africans fighting with each other?
In the movie amistad

Answers

Answer:

I think that they were put to fight each other for freedom. (Africans are slaves in that movie)

Explanation:

None, really. Just that Africans are slaves in that movie and that they were put to battle among themselves for freedom.

- ❤ 7272033Alt ❤

Which resource did early civilizations settle by?

Answers

Answer:

Hey mate....

Explanation:

This is ur answer....

Rivers were attractive locations for the first civilizations because they provided a steady supply of drinking water and made the land fertile for growing crops.

Hope it helps!

Brainliest pls!

Follow me! :)

Answer:

im not sure make sure to use your brains kids

Explanation:

do good.

Find the equation of the line specified. The line passes through the points ( 2, 1) and ( 5, 4) a. y = x + 1 c. y = x - 1 b. y = -x - 1 d. y = x + 3 Please select the best answer from the choices provided A B C D

Answers

im not sure i need help on this to

Explanation:

The Senate of Texas charges a tax of twenty cents ($.20) per gallon on the purchase of a gallon of gasoline.

— Sec.162.102

The United States government imposes an excise tax of 18.4 cents per gallon on the sale of gasoline at the pump.

— Federal Tax Code


The two excerpts above illustrate the principle of —

Answers

The actions of both the Senate of Texas and the U.S. government illustrate the principle of Federalism.

Federalism:

Allows for the existence of different levels of government.Allows for different levels of government to have certain powers in relation to their jurisdiction.

The Senate of Texas was able to impose that tax on Texas whilst the U.S. government is able to impose it on the entire U.S. which shows that federalism is at play.

In conclusion, this is a demonstration of federalism.

Find out more about federalism at https://brainly.com/question/25858235.

Can someone plz help me?

Answers

The answer should be D
the answer should be D if not ask for help.

Barriers and road markings can help protect vulnerable users by keeping a separation between

Answers

Barriers and road markings are there to protect vulnerable road users by separating the lanes used by road users.

Vulnerable road users include:

Pedestrians Motorcyclists Cyclists

Barriers and road markings separate the lanes used by motorists in cars and those used by these vulnerable road users to ensure that the motorists don't injure them.

In conclusion, the lanes are separated to protect vulnerable road users.

Find out more on Vulnerable road users at https://brainly.com/question/2710060.

Why were Europeans eager to explore and colonize the Americas after the
15th century?
A. Religious leaders ordered European missionaries to spread Islam
to new lands.
B. Asian empires could easily trade with Europeans in the Americas.
C. Discovering new lands brought fame and glory to European
explorers.
O D. European revolutionaries hoped to establish democracies in the
Americas.

Answers

Answer:

C

Explanation:

Most European explorers like Christopher Columbus wanted to explore and claim new lands for fame and power and the Americas were no different.

Answer: I think it might be C not a 100% sure

Explanation:

What happened after Israel declared its independence on May 14, 1948?

Answers

After Israel declared its independence on May 14, 1948, the fighting intensified with other Arab forces joining the Palestinian Arabs in attacking territory in the former Palestinian mandate. ... This action was followed by the invasion of the former Palestinian mandate by Arab armies from Lebanon, Syria, Iraq, and Egypt.

Which research questions are effective? Choose three correct answers.
Who were the samurai?
Did the samurai have unique characteristics?
How did the samurai influence modern Japan?
Why did the samurai code influence Japanese culture?
How did the samurai code influence people who were not warriors?

Answers

Answer:

c d e

Explanation:

Based on the excerpt, how did Republicans in 1860 feel about slavery? A. That it was none of the Republican's business to declare slavery legal or illegal, for
this power rested with the Supreme Court
B. That, even though the African Slave Trade was outlawed, sourcing slaves a different
way was admissible
C. That slavery's expansion into the territories was dangerous and that slavery violated
the Constitution
D. That it was perfectly legal and in fact necessary to the progress of the United States

Answers

Answer:

C

Explanation:

Which phrases describe ways the United States acquired outlying areas?

Choose all answers that are correct.


a engineering a takeover

b acquiring the land

c fighting a war

d purchasing the land

Answers

Answer:

B

C

D

Explanation:

how did the french become involved in the vietnam war

Answers

Answer:

The French were fighting in Vietnam to maintain their colonial power and to regain their national pride after the humiliation of World War II.

Explanation:

From the 1830s on, pioneers hoping to settle on America’s western coast

Answers

Answer:

avoided the Cumberland Gap. made their way along the Oregon Trail

Explanation:

Answer:

avoided the Cumberland Gap. made their way along the Oregon Trail

Explanation:

avoided the Cumberland Gap. made their way along the Oregon Trail

what might caues somone metal map of a place to change

Answers

Answer:

What might cause someone's mental map of a place to change? A mental map describes an individuals perception of features of earths surface, so things might have changed and places may have changed.

Explanation:

in greek mythology, who lures sailors to their deaths with their sweet song?

Answers

Answer:

The Sirens

Explanation:

The Seirenes (Sirens) were three monstrous sea-nymphs who lured sailors to their death with a bewitching song. They were formerly handmaidens of the goddess Persephone and when she was secretly abducted by Haides, Demeter gave them the bodies of birds to assist in the search.

What sort of faith did Americans place in the increased number of inventions in their
lives around 1900?

Answers

Answer:

The years between the election to the presidency of James Monroe in 1816 and of John Quincy Adams in 1824 have long been known in American history as the Era of Good Feelings. The phrase was conceived by a Boston editor during Monroe’s visit to New England early in his first term. That a representative of the heartland of Federalism could speak in such positive terms of the visit by a Southern president whose decisive election had marked not only a sweeping Republican victory but also the demise of the national Federalist Party was dramatic testimony that former foes were inclined to put aside the sectional and political differences of the past.

Which were provisions of the Treaty of Versailles? Select five answers. Germany took responsibility for having started the war. Germany had to pay reparations to other nations. Germany had to limit the number of its ships. Germany had to join the League of Nations. Germany had to give up its armed forces. Germany could not acquire new weapons or war materials. Germany had to give up its colonies.

Answers

The provisions of the Treaty of Versailles as signed by Germany and all countries affected were:

Germany took responsibility for having started the war. Germany had to pay reparations to other nations. Germany had to give up its armed forces. Germany could not acquire new weapons or war materials. Germany had to give up its colonies.

According to the given questions, we are asked to state the answer choices which were provisions of the Treaty of Versailles as they were signed by all the countries involved.

As a result of this, we can see that the Treaty of Versailles was the deal which the successful nations had to make Germany sign for starting the War which claimed a lot of lives and destroyed infrastructures, thereby affecting global economies.

Read more about the Treaty of Versailles here:

https://brainly.com/question/1139098

Answer:

Germany took responsibility for having started the war.

Germany had to pay reparations to other nations.

Germany had to give up its armed forces.

Germany could not acquire new weapons or war materials.

Germany had to give up its colonies.

Explanation:

Which of the following would best
describe the term benevolent?
A. A place in on earth where it is hot
B. A person who is considered a criminal
C. A God that wants to do harm or injure
D. Something that is good or kind in nature

Answers

Answer:

D. Something that is good or kind in nature

Other Questions
If (6^2]^p = 6^10, what is the value of p? A.) 2 B.) 3C.) 4D.) 5 has anyone done this and if u have please help me !! :(( How many moles does 205 g of helium,He, contain ? which best explains the impact of european colonization on the inca and aztec civilizations? When is it best to solve a system of equations using substitution? As part of the Monroe Doctrine, the United States demanded that Europeanpowers:O A. stop participating in the trading of enslaved people.B. establish democratic forms of government.C. give up all of their Caribbean colonies.O D. stop interfering with affairs in the Americas. A change in momentum is also called:a. Impactb. Imputc. Impulsed. Impole Calculate the energy for vacancy formation in nickel. what are the parts system unit LAST ATTEMPT IM MARKING AS BRAINLIEST!! (Draw a dilation of the figure using the given scale factor ) 2. List the like terms in each of the followingi) 4x2 , -5x , 6 , 7x , -2x2 , -3 how long do we have until climate change is irreversible 3.Original DNA sequence: 3' TACCGCTTACGTCTGATCGCT 5' Mutated DNA sequence: 3' TACCGCTTATTATTACGTGCTGCTATCGCT 5' Type of mutation (3pts): Amino acid ( 3pts): Type of mutation ( 3pts): 4. Original DNA sequence: 3' TACCGCTTACGTCTGATCGCT 5' Mutated DNA sequence: 3' TACCGCTAATTATTACGTGCTGCTATCGCT 5' Type of mutation ( 3pts) : Amino acid ( 3pts): Type of mutation ( 3pts): you---- write to your mother every week since she missed you too mucha.better b.better had c.should d.ought A tram moved downward 9 meters per second for 54 seconds. What was the total change in the tram's elevation? Draw the following vector: 350 N, 30 south of east [1 cm = 50 N] 1. One atom contains 29 protons and 34 neutrons. Another atom of the same element has a mass number of 65. How many protons and neutrons does this unknown atom have?A. 28 protons, 37 neutronsb. 29 protons, 36 neutronsC. 29 protons, 35 neutronsD. 31 protons, 34 neutrons 14. Which has the lowest ionization energy?A. beryllium (Be) B. strontium (Sr) Calcium (Ca) D. magnesium (Mg) Simplify this question Look at the circuit given below. It consists of a cell, a bulb with two terminals X, Y and wires. P, Q, R and S are positions marked. What is the direction of the flow of current? a) PQXYRS b) SRYXQP c) SPQXYR d) PSRYXQ