Why are matter and energy cycles important to an ecosystem ?

Answers

Answer 1

Answer:

Carbon and nitrogen are examples of nutrients. Unlike energy, matter is recycled in ecosystems. ... Decomposers release nutrients when they break down dead organisms. The nutrients are taken up by plants through their roots

Explanation:


Related Questions

together with Fr. Diego Luis de San Vitores, SJ , where did they go to evangelize? What heroic act merited him a martyr's crown?​.​

Answers

Answer: The spread of Christianity among the Jews was the heroic act of San Vitores.

Explanation:

He was murdered on the island of Guam on 2 April 1672. He brought Christianity to the CHamoru people. He was killed  by the chief's daughter Mata' pang with a sword. His conversion efforts were commendable. The CHamorus people  welcomed San Vitores and hundreds of people were readily converted into Christians readily. Today Catholism is the main religion in Guam.

Match each underlined word to its correct meaning based on the context of the sentence. Tom had long been picking his way cautiously through this treacherous forest; stepping from tuft to tuft of rushes and roots, which afforded precarious footholds among deep sloughs. It was a dreary memento of the fierce struggle that had taken place in this last foothold of the Indian warriors. He was sulky, however, and would not come to terms: she was to go again with a propitiatory offering, but what it was she forbore to say. At this propitious time of public distress did Tom Walker set up as a usurer in Boston.

Answers

Answer:

A. Tom had long been picking his way cautiously through this treacherous forest;  stepping from tuft to tuft of rushes and roots, which afforded precarious footholds among deep sloughs.  - 3.dangerous.

B. It was a dreary memento of the fierce struggle that had taken place in this last foothold of the Indian warriors. - 4.bleak.

C. He was sulky, however, and would not come to terms: she was to go again with a propitiatory offering,  but what it was she forbore to say. - 2.conciliatory.

D. At this propitious time of public distress did Tom Walker set up as a usurer in Boston. - 1.favorable .

Explanation:

The given underlined words in each sentence are-

1. "Precarious" refers to something unstable, unconfirmed, dangerous, uncertain, unreliable. So, when used in the given sentence, it suggests the dangerousness of the foothold that Tom had to depend on.

2. The word "dreary" is also used for something dull, uninteresting, bleak. It is used to describe the banal, cheerless memento of the fight the Indian warriors had given.

3. "Propitiatory" is another word used to describe something that is like a conciliatory offering, a token of appeasement, or trying to please someone or something. In the given sentence, it is used to describe how she will be offering a conciliatory act to him.

4. The word "propitious" is synonymous with something favorable, advantageous, presenting a promising idea. And in its use, the sentence presents how the public distress is favorable for Tom Walker to set up his office.

Answer:

- 3.dangerous. Tom had long been picking his way cautiously through this treacherous forest;  stepping from tuft to tuft of rushes and roots, which afforded precarious footholds among deep sloughs.

- 4.bleak. It was a dreary memento of the fierce struggle that had taken place in this last foothold of the Indian warriors.

- 2.conciliatory.

He was sulky, however, and would not come to terms: she was to go again with a propitiatory offering,  but what it was she forbore to say.

- 1.favorable . At this propitious time of public distress did Tom Walker set up as a usurer in Boston.

Explanation:

Advantages of using tidal power include O no alr pollution
Otides are predictable
O low environmental Impact
O all of these​

Answers

Answer:

all of these :)

Explanation:

i think

Answer:

Yes The Correct answer is ( All Of These)

explanation:

Through scientific research, genetic technologies have advanced the study of gene sequences. Which is a main benefit of gene therapy technology?
a. The ability to cure genetic diseases by replacing defective genes
b. The ability to genetically design organisms that have never existed
c. Understanding how human genes turn on and off to make carbohydrates
d. Making genetically superior plants and animals to benefit the entire world.​

Answers

Answer:

a. The ability to cure genetic diseases by replacing defective genes

Explanation:

Why do the cells used for reproduction only have half (½) of the DNA that other cells have?

Answers

Answer:

Because each chromosome has a pair, these cells are called "diploid" cells. On the other hand, human sperm and egg cells have only 23 chromosomes, or half the chromosomes of a diploid cell.

Explanation:

Which belongs in each place

Answers

Answer:

1=e, 2=b, 3=c, 4=d, 5=a

Explanation:

.

The energy related to the motion of an object is called ___.

Answers

Answer:

The answer is  kinetic energy

Explanation:

Kinetic energy is the correct answer

A plant or animal that carries a disease or parasite during part of its life cycle is called a(n):

Answers

Answer:

it could probably be host

Answer:

A plant or animal that carries disease or parasite during part of its life cycle is called a host

I HOPE IT HELPS ❤❤

5. Why might a cell need to phagocytose?

Answers

Answer:

Phagocytosis is a critical part of the immune system. ... By knowing the enemy, the cells of the immune system can specifically target similar particles circulating in the body. Another function of phagocytosis in the immune system is to ingest and destroy pathogens (like viruses and bacteria) and infected cells.

Explanation:

In a series of rock layers, where do you find the oldest layers? Explain why?
Your answer
Please helppp meh!!

Answers

Answer:bottom

Explanation:

Please help I'm behind

Answers

Answer:

B : Barometer

Explanation:

A barometer is a scientific instrument used to measure atmospheric pressure, also called barometric pressure. The atmosphere is the layers of air wrapped around the Earth. That air has a weight and presses against everything it touches as gravity pulls it to Earth. Barometers measure this pressure.

Write a sentence about tissues. (ITS FOR SCIENCE SO PLS)

Answers

Answer: There are 4 basic types of tissue: connective tissue, epithelial tissue, muscle tissue, and nervous tissue. Connective tissue supports other tissues and binds them together (bone, blood, and lymph tissues). Epithelial tissue provides a covering (skin, the linings of the various passages inside the body)

construct a flowchart (using “->”) (or explain) that depicts all the energy transfers that occur from the sun to the milk of your cereal

Answers

Answer:

dragon warrior or whatever it is called I don't maybe I am right

10. Modern telescopes make it possible for astronomers to detect planets around distant stars. Why couldn't
astronomers detect these planets before?
A. The planets are much closer than the stars they orbit.
B. The planets are much larger than the stars they orbit.
C. The planets are much farther than the stars they orbit.
D. The planets are much smaller than the stars they orbit.

Answers

Answer:

I would Say the answer is D

Explanation:

Answer:

I I think it’s D

Explanation:

D the planets are much smaller than the stars they orbit.

The diagram shows the moving molecules in a beaker of liquid. What will happen if the molecules increase their speed?

A.
the liquid will become a solid

B.
the temperature of the liquid will increase

C.
the temperature of the liquid will decrease

D.
the molecules will gain mass

Answers

Answer:

I believe the answer to this question is B

Need help please would mean a lot

Answers

Answer: the anwser is C

Explanation:

Describe each type of mountain. Include the type of boundary where they are likely formed and characteristics of each. Folded Mountains: Fault-block Mountains:

Answers

Answer:

Folded mountains are all those originated by movements and collisions of the great plates that form the earth's crust. Fault-block mountains are those that appear from a break in the crust, a fact that causes the rock blocks to move up and down and form elevations.

Explanation:

The parallel movement of the earth's crust leads to the appearance of Folded Mountains. According to this theory, Folded Mountains originate from the collision between two tectonic plates. Some of these plates are huge and can support and carry entire continents. When two plates collide, the denser one gets under the other, and this causes the sediments deposited in the basin or geosyncline that separated them to fold up. The large folds formed in the compressed sediment can break apart and form mountains.  Fault-block Mountains are related to normal wide-angle faults that gradually decrease in dip with depth. Most of the Fault-block Mountains form in response to a large uplift.

Summarize in 2-3 sentences, how an RNA vaccine works to help protect you against
viruses?
I

Answers

Answer:

boost your immune system

Explanation:

Answer:

Vaccination is the process in which substances called antigens are introduced artificially into the body to stimulate the immune system, the set of cells that protects the body against infections .

The electrons that travel through electron transport chain #1 (and that have been excited off of the chlorophyll molecules on photosystem #2) are used to

Answers

Answer:

energy released in these electron transfers is used to form an electrochemical gradient. In chemiosmosis, the energy stored in the gradient is used to make ATP.

Explanation:

Hope this helps :)

What abiotic factors might affect a population of fish? Check ALL that apply.

clear water
light
temperature
food

Answers

Answer:

Clear water, light, and tempature.

Explanation:

True or False: Epinephrine enters
the cell after it binds to the receptor.

Answers

i believe it’s true ...

Epinephrine enters the cell after it binds to the receptor. Yes, this statement is true.

What are the functions of epinephrine?

Adrenaline, also known as epinephrine, is a hormone and medication which is involved in regulating visceral functions. It appears as a white microcrystalline granule.

Epinephrine injection is used for emergency treatment of severe allergic reactions (including anaphylaxis) to insect bites or stings, medicines, foods, or other substances.

Through its action on alpha-1 receptors, epinephrine induces increased vascular smooth muscle contraction, pupillary dilator muscle contraction, and intestinal sphincter muscle contraction.

Learn more about epinephrine:

https://brainly.com/question/3882731

#SPJ2

True or false the main source of energy and water cycle is gravity

Answers

Answer:

False please mark me brainlest.

Explanation:

Increasing the number of coils in a solenoid or an electromagnet results in a ___
magnetic field.

Answers

Answer: Stronger Magnetic Field

Explanation:

The magnetic field in a solenoid is given by

[tex]B=\mu nI[/tex]

where B=magnetic field

[tex]\mu=[/tex]Permeability

n=no of turns per unit length

I=Current through solenoid

When No of turns increases, it increases the strength of the magnetic field.  

Answer:

Hey I saw that you had the Geometry end of year review escape room I was wondering if you maybe had the answers and work for the rest of the pages?

Explanation:

Thank u

What is the role of enzymes in the DNA replication process?
A. Enzymes read the DNA code and build a new DNA molecule from scratch.
B. Enzymes link together to form a template for a new DNA molecule to be built.
C. Enzymes split the DNA molecule into two rails and then transport corresponding nitrogenous bases to each rail.
D. Enzymes link adjacent nucleosides together, becoming an integral part of the structure of the new strands of DNA.

Answers

Answer:

B.

Explanation:

decode CCGCTTTCGCTATTATAAAAAGGGCTATAACTA

Answers

Answer:

GGCGAAAGCGAUAAUAUUUUUCCCGAUAUUGAU. I think sorry if I'm wrong

I’m not sure if anyone knows this or not, can someone try and help me with this question!

Answers

Answer:

it gives them a mental picture of where they need to plant and pick the cotton

Explanation:

Hope this helps

Eukaryotic cells can be specialized for specific tasks in multicellular organisms

true
false

Answers

It is true from my looking

(GIVING BRAINLIEST!!)
Which common characteristic of planets do Saturn and Earth share?

A) They have rings.
B) They have moons.
C) They are made of rock.
D) They have thick atmospheres.

Answers

Answer:

THEY HAVE MOOOONNNNSSSSS

Explanation:

The answer is C. Earth doesn’t have rings. Saturn has way more moons then earths

Which natural resource is nonrenewable?

sunlight


sugarcane


oil or petroleum


corn​

Answers

Answer:

There are four major types of nonrenewable resources: oil, natural gas, coal, and nuclear energy. Oil, natural gas, and coal are collectively called fossil fuels.

The natural resource is nonrenewable oil or petroleum is a carbon primarily based totally gasoline .

What are nonrenewable resources?

There are 4 essential varieties of nonrenewable resources: oil, herbal gas, coal, and nuclear energy.

Oil is a carbon primarily based totally gasoline that bureaucracy while plant and animal stays are uncovered to intense situations which include excessive pressure (eg below a dust layer on the sea floor.) for hundreds of years. Therefore the oil we use these days took millennia to form.

Read more about oil here:

https://brainly.com/question/25614315

#SPJ2

1. What Does DNA stand for?​

Answers

Answer:

deoxyribonucleic acid

DNA stands for deoxyribonucleic acid.
Other Questions
2 What are the social effects of population growth Why is it important to respect other political opinions?OA. It allows politicians to gain new voters,B. It creates a more informed electorate,Oc. It helps citizens change their minds on political issues,OD. It leads to improvements in the education system. Which weighs more: a watermelon that weighs 7.5 kilograms or a baby that weighs 12 pounds? O salrio de um artista calculado atravs da funo y = 2000 + 500x onde Y representa o valor total em Reais recebido em um ms de trabalho e "x" o nmero de shows realizados no ms. Qual foi o salrio desse artista no ms em que realizou 12 shows? if you had to analyze a text written by someone involved in the ratification debate, how would you be able to distinguish between a text written by an Anti-Federalist and one written by a Federalist? A group of people who do not have the freedom to select which news reports that they read are under _____. censorship edition monitoring Fred has 45 books. Sally has 27 times more books than Fred. How many books does Sally have? Tell whether the sequence is arithmetic. If it is, identify the common difference.3,6,12,24 Translate to have fun into Spanish The distance from C to D is 24 miles. The distance from B to C is 2/3 of the distance from C to D. The distance from A to B is 3/8 of the distance from B to C. What is the distance from A to B? Editing is an important part of the journalistic process Select the correct answer.Which hexadecimal number has the same value as this binary number?01111001OA 71oOB. 9,oOC. 79,6OD. 97,6 I NEED HELP ASAP! ILL GIVE YOU A PET IN ADOPT ME OR ILL MARK YOU BRAINLIEST!!! PLZ Mike removed 56 marbles from his marble box and put them into 8 equal groups. How many marbles were in each group? six and twenty-three thousands in standard form please help me find each unit price "Her favorite place to get breakfast is Chick-Fil-A, but they are closed on sundays" is this a simple or compound sentence? Find the area of this parallelogram. He is of average height and has a solid build owing to the years he spent as a construction worker. His face is not too wrinkled but his complexion is ruddy. He often keeps his white hair covered with a straw hat that protects him from the sun. He is usually casual dressed and he dislikes wearing a suit and a tie.He is of average height and has a solid build owing to the years he spent as a construction worker. His face is not too wrinkled but his complexion is ruddy. He often keeps his white hair covered with a straw hat that protects him from the sun. He is usually casual dressed and he dislikes wearing a suit and a tie.He is of average height and has a solid build owing to the years he spent as a construction worker. His face is not too wrinkled but his complexion is ruddy. He often keeps his white hair covered with a straw hat that protects him from the sun. He is usually casual dressed and he dislikes wearing a suit and a tie.Round characterFlat characterizationAll of these answers are correct.Indirect characterization HElP ME PLEASE 20 POINTS!!!!!!!!!!!!!!!!!!