write a thesis statement supporting your candidate with 3 reasons why that candidate should be president of the united states .

Answers

Answer 1

Answer:

ualifications for presidential candidates have remained the same since the year Washington ... George Washington, first president of the United States ... whether I would accept or refuse the Presidency of the United States," Washington revealed in a 1789 speech.

Explanation:


Related Questions

PLEASE DO THIS!!! i beg you!!!

Answers

Answer:

the Continental Army had just endured a punishing winter at Valley Forge. And a stranger - former Prussian army officer bear and Frederick Wilhelm von Steuben Josh was on the scene to restore morale, introduce discipline and with the tattered soldiers into fighting shape. he is credited with forming a mature continental army into a progressional fighting force. Bone Steven published his famous "Blue Book", first training manual for the American Army

Explanation:

hope this helps :]

Answer:

D.) Foreign Leader to aid America

Explanation:

Baron Friedrich von Steuben, a Prussian military man hired by George Washington to whip the Continental Army into shape during the darkest days of the Revolutionary War, is known for his bravery and the discipline and grit he brought to the American troops.

Wilson called the United States "the one great nation at peace." What does he hope to accomplish by staying out of war?​

Answers

Answer: There are several reasons why Woodrow Wilson sought to avoid the departure of American troops to war.

Explanation:

Even after open German hostility to America, Wilson sought to avoid dragging his country into the war. The president primarily followed the initial course of the neutrality of the United States. Moral principles played an important role, and this is one of the additional reasons. Americans globally (except for a small number) were not interested in going to European battlefields, so Wilson did not want to risk possible re-election as president. The United States also made a lot of money during the war because it sold weapons; the president did not want to jeopardize the country's inflow of money. Thus, political, economic, and moral reasons are why Wilson did not want to include the country in the war.

what is mineral Revolution​

Answers

Answer:

The Mineral Revolution is a term used by historians to refer to the rapid industrialisation and economic changes which occurred in South Africa from the 1870s onwards

Explanation:

The Chancellor of the Exchequer ___, led Parliament in continuing to levy new taxes on the colonists.

Answers

Answer:

Charles Townshend

Explanation: In 1767, William Pitt was returned to the office of Prime Minister, which should have been beneficial to the colonies. However, Pitt was ill and therefore ineffective. The new Chancellor of the Exchequer, Charles Townshend, would have the responsibility of dealing with the colonies. This development was not beneficial to the colonies. Townshend believed in mercantilism and therefore was more concerned with the economy of England than with the rights of the colonies. He believed that the colonists were not paying their fair share of the cost of their own defense.

Who was the first person to the moon?

Answers

Answer: Neil Armstrong.

Explanation: Although America was not the first country to attempt landing on the Moon, the country was the first successful mission.

Answer:

Neil Armstrong

Explanation:

On July 20, 1969, Neil Armstrong became the first man to step on the moon.

Hope this helped! If so, plz mark me brainliest.

Select the three sections of the Declaration of Independence.

A.) pledge for support from foreign allies
B.) declaration of independence from England
C.) grievances against England
D.) political principles
E.) pledge to remain loyal British citizens

Answers

B) Declaration of Independence from England
D)Political principles
E) pledge to remain loyal British citizens

Answer:

c.) grievances against England

b.)  declaration of independence from England

e.)  pledge for support from foreign allies

Explanation:

The Declaration of Independence of the United States of America is a document drafted by the Second Continental Congress - in the Pennsylvania State House (now Hall of Independence) in Philadelphia on July 4, 1776 - which proclaimed that the Thirteen American Colonies - then at war with the Kingdom of Great Britain-they had defined themselves as thirteen new sovereign and independent States and no longer recognized British rule; instead, they formed a new nation: the United States. John Adams was one of the politicians who undertook the independence process, approved on July 2 by the full Congress without opposition. A committee was responsible for drafting the formal statement, which was presented when Congress voted on it two days later.

Why did Claiborne make changes to laws regarding African Americans in Louisiana?

to make Louisiana laws more equal for blacks and whites
to make Louisiana laws more in line with other US states
to improve the status of free persons of color in Louisiana
to improve the relations between races in Louisiana

Answers

Answer:

B- to make louisiana laws more in line with other us states

Explanation:

IT JUST IS Lol

Answer:

The answer is , B to make louisiana laws more in line with other US states .

Explanation:

In the mid-1300s, John Wycliffe was

a critic of the Protestant Church.
a reverend in the Protestant Church.
a critic of the Catholic Church.
a leader in the Catholic Church.

Answers

Answer:

prostet as basic ti ihhhyir difficult

Explanation:

g7 of st tui gridironfoodie

Answer:

he was a critic of the Catholic Church.

Explanation:

What are the two elected officials of the executive branch

Answers

Answer:

The President is both the head of state and head of government of the United States of America, and Commander-in-Chief of the armed forces. Under Article II of the Constitution, the President is responsible for the execution and enforcement of the laws created by Congress.

Explanation:

Hope this helped! Good luck!

President and Vice President are two officials of the executive branch. Also there’s the cabinet members as well. Hope it helps.

What is one way that the thirteen colonies were similar to the western frontier?
Both had a wealth of precious metal resources.
Both had dense forests and fertile farmland.
Both had been fully explored before settlers came.
Both had been uninhabited before settlers arrived.

Answers

Answer:

Both had dense forests and fertile farmland.

Explanation:

The one way that the thirteen colonies were similar to the western frontier was that they both had dense forests and fertile farmlands.

During this period there was a very little amount of civilization, road networks and urbanization which was why there were dense forests all over. Fertile farmlands was as a result of the optimal activities of organisms in the ecosystem.

Answer:

B.  Both had dense forests and fertile farmland.

would be your answer.

Explanation:

Have a great day!!

blm black lives legit matter you go komola harris!

Answers

Answer:

boyyyy im black tooo

Explain the role and influence of William H. Murray during the Oklahoma Constitutional Convention (Site 2) B I US TE I​

Answers

Answer:

Murray played a dominant role in drafting the constitution, both as presiding officer and in making appointments to and directing the work of committees. He often endorsed progressive reforms similar to the ones he had supported as a delegate to the earlier Sequoyah Convention.

Explanation:

Correct on Edge2020

Answer:

Murray played a dominant role in drafting the constitution, both as presiding officer and in making appointments to and directing the work of committees. He often endorsed progressive reforms similar to the ones he had supported as a delegate to the earlier Sequoyah Convention.

Explanation:

This is what I put and got 100%

What effect did mass production have on society ​

Answers

Answer:

In real life, mass production led to worker unrest, turnover, and social conflict. Unionization efforts intensified as workers became more alienated in the factory setting. Thus, the advent of mass production had both positive and negative effects on society.

rulers of the Zhou dynasty established the mandate of heaven to

Answers

The Zhou created the Mandate of Heaven: the idea that there could be only one legitimate ruler of China at a time, and that this ruler had the blessing of the gods. They used this Mandate to justify their overthrow of the Shang, and their subsequent rule

the political map shows major cities in Louisiana.



What are the approximate latitude and longitude coordinates for Lake Charles, Louisiana?

30° N, 91° W
32° N, 94° W
30° N, 90° W
30° N, 93° W

Answers

Answer:

a

Explanation:

What were the working conditions in factories and mines

Answers

They were dangerous and unforgiving places to work. The people of that working class were known to work long hours up to 12 to 16 hour shifts. Not to mention earning low wages that barely covered the cost of living. They places were very dirty with little or no worker rights.

Drag each feature to the correct category. Identify the effects of the french and Indian war. on the american colonists. (Choose 2 sentences to match to each category)

Two categories: American Colonists, American Indians

A. Heavy taxes imposed upon them by the British government

B. not able to acquire the land west of Allegheny Mountains

C. Faced hatred from british soldiers for supposed massacre

D. Forbidden to move west of the proclamation line by British government ​

Answers

Answer:

A,D,B,C

Explanation: American colonists: A and D

American Indians: B and C

Dragging  each feature to the correct category as-

American Colonists-

Heavy taxes imposed upon them by the British governmentForbidden to move west of the proclamation line by the British government ​

American Indians

not able to acquire the land west of the Allegheny MountainsFaced hatred from British soldiers for a supposed massacre.

What are the causes of the french and Indian wars?

The French and Indian War began over the acquisition of the upper Ohio River valley which belonged to the French Empire, in this case, it was closed to trade with Old Dominion (V)  and Pennsylvania, making it available for settlement and settlement by those two states' citizens.

In February 1763, the Paris Treaty was signed, which brought an end to the French and Indian War. While giving France the right to maintain its West Indian sugar islands and handing Spain Louisiana, the British took Canada from France and Florida from Spain.

To protect their ownership of their territory and their cultural heritage, the American Indians struggled. Upper Ohio River Valley was claimed by the French. They intended to occupy the area and facilitate business with the American Indians.

Learn more about the French-India war, here:

https://brainly.com/question/793133

#SPJ5

What gave the patriots a military advantage over the British during the revolutionary war?

A: The British could not raise enough money to fund the war

B: The war was fought far from the patriots homes

C: France and Spain have the Patriots money and supplies

D: The Continental Army was made up of professional soldiers

Answers

Answer:

C

Explanation:

If the French and Spain countries had not helped the patriots, the partriots were most likely to lose since they could hardly even pay their own soldiers during this time. So because of the help from France and Spain, the patriots were able to gain an advantage over the British.

What does “be determined by adding the whole number of free people” mean? What are they saying here? BTW, this is from the 3/5 Compromise.

Answers

It meant the taxes were divided based off of population of “whole people” which would be people who weren’t slaves

Who made up the Populist Party? What were their platforms?

Answers

Answer:

Explanation:

James Baird Weaver  and Leonidas L. Polk

The Populist platform represented views of farmers in the West.

Name 4 ways Southern Whites prevented African Americans from voting?

Answers

Answer:

1) Violence: Blacks who tried to vote were threatened, beaten, and killed.  Their families were also harmed.  Sometimes their homes were burned down.  Often, they lost their jobs or were thrown off their farms.

Whites used violence to intimidate blacks and prevent them from even thinking about voting. Still, some blacks passed the requirements to vote and took the risk. Some whites used violence to punish those “uppity” people and show other blacks what would happen to them if they voted.

2) Literacy tests: Today almost all adults can read.  One hundred years ago, however, many people – black and white – were illiterate.  Most illiterate people were not allowed to vote. A few were allowed if they could understand what was read to them.  White officials usually claimed that whites could understand what was read. They said blacks could not understand it, even when they clearly could.

3) Property tests: In the South one hundred years ago, many states allowed only property owners to vote.  Many blacks and whites had no property and could not vote.

4) Grandfather clause: People who could not read and owned no property were allowed to vote if their fathers or grandfathers had voted before 1867.  Of course, practically no blacks could vote before 1867, so the grandfather clause worked only for whites.

Explanation: From about 1900 to 1965, most African Americans were not allowed to vote in the South. This was especially true in the Deep South: Louisiana, Mississippi, Alabama, Georgia, and South Carolina.

White people in power used many methods to keep African Americans from voting.  Some of these methods also prevented poor white people from voting.

One thing Qin Shi Huang did to unite China was:

A. use a standardized money system.

B. cut off trade along the Silk Road.

C. force all people to follow Confucianism.

D. reduce the size of the military.

Answers

Answer:

The answer is A. Hope this helps!

Explanation:

Answer:

The answer is A. Use a standardized money system.

Explanation:

This is correct I have the same thing for school.

Which of the following best describes how Hammurabi's Code and the Jewish Ten Commandments are similar?
a. they established guidelines for building homes
b. they outlined the duties for specific jobs in society
c. They described the best agricultural practices for farmers to use
d. they provided consistent codes of law for their societies

Answers

Answer:

Explanation:

I thinks it D i'm so sorry if its wrong

Townshend Act (1767)-Why is this considered an indirect tax? Pg 121

Answers

Answer:

Indirect taxes are commonly used and imposed by the government in order to generate revenue. They are essentially fees that are levied equally upon taxpayers, no matter their income, so rich or poor, everyone has to pay them.

Explanation:

What is one way that the thirteen colonies were similar to the western frontier?
Both had a wealth of precious metal resources.
Both had dense forests and fertile farmland.
Both had been fully explored before settlers came.
Both had been uninhabited before settlers arrived.

Answers

Answer:

Both had dense forests and fertile farmland.

Explanation:

Answer:

Both had been fully explored before settlers came.

Explanation:

Why did the Battle of Thermopylae become legendary?

A. The Greeks won a surprise victory, and the Persians retreated.
B. The battle caused the Peloponnesian Wars between Athens and Sparta.
C. Dozens of Spartan warriors held off the entire Persian army for three days.
D. A Greek navy led by Themistocles trapped and destroyed the Persian navy.

Answers

Answer:

C-Dozens of Spartan warriors held off the entire Persian army for three days.

Explanation:

Battle of Thermopylae became legendary among the Greeks.  Three hundred Spartan warriors set up defenses in the mountain pass.  A sheer cliff protected their left, and the sea was on their right.  They held off the Persians for three days.  The Persians went on to burn Athens

The Battle of Thermopylae became legendary because dozens of Spartan warriors held off the entire Persian army for three days. Hence, Option C is correct.

What was the Battle of Thermopylae?

Thermopylae was fought between a coalition of Greek city-states commanded by Sparta under Leonidas I and the Achaemenid Persian Empire under Xerxes I.

It lasted for three days and was one of the most notable conflicts of the larger Greco-Persian Wars as well as the second Persian invasion of Greece. Greek soldiers commanded by King Leonidas of Sparta were defeated by a Persian army under Xerxes I in the Battle of Thermopylae

Between July and September, Battle of Thermopylae took place at the same time as the Battle of Artemisium. The first Persian invasion, led by Darius I and unsuccessfully countered by an Athenian-led Greek victory at the Battle of Marathon, was followed by a second invasion by the Persians under Xerxes I.

Therefore, Option C is correct.

Learn more about Battle of Thermopylae from here:

https://brainly.com/question/928434

#SPJ6

I need help with this question fast plz

Answers

bruh you didn't give us the pdf to read so how are we supposed to know

An ancient copper coin found in the East African port of Kilwa is the same kind of coin
that was used during the Middle Ages in Great Zimbabwe, 1500 miles away along the
Limpopo River. What does this discovery reveal about trade in Africa during that time?

Answers

Answer:

Kiliwa was a big trading point for gold, slaves, ebony, and ivory. People came from all over to trade at Kiliwa. What this says is that the great Zimbabwe traveled across the Limpopo river to trade at the large trading ports in Kiliwa.

Explanation:

A significant trading hub for ebony, ivory, ebonized slaves, and gold was Kiliwa. To trade at Kiliwa, people came from all over the world. This indicates that the great Zimbabwe crossed the Limpopo River to conduct business at the significant commercial ports at Kiliwa.

What is an ancient copper coin ?

The as, also known as the assarius plural assarii, transliterated as v, assárion in Greek, was a bronze coin that was used during the Roman Republic and Roman Empire.

The Romans had a wide range of copper coins, although the Greeks only used a few of them. Roman letters A and S most likely initially stood for one pound of unminted copper. The first six ounces, which totaled twelve, were represented by copper coins.

Silver and copper may be formed into any shape without breaking since they are metals. Additionally, because these metals are less reactive, corrosion does not occur as frequently. They are suitable for usage in coinage because of these characteristics.

Thus, A significant trading hub for ebony, ivory, ebonized slaves,

For more information about ancient copper coin, click here

https://brainly.com/question/28605364

#SPJ2

European nations established colonies in the New World because they were relying on an economic system known as mercantilism. Which of the following "rules of thumb" provides the best summary of the theory of mercantilism?A.it's best to import raw materials and export finished productsB.the bigger the population, the stronger the economyC.human labor is cheaper than raw materialsD.don't ever trade with nation's that are economic competitors

Answers

Answer:

D

Explanation:

what was the purpose of Zheng He's voyages? Choose three correct answers.

Answers

Answer:

A D E have a blessed day and remember don't be toxic to people

Exploration and Diplomacy: Zheng He's voyages aimed to establish diplomatic and trade relations with other nations. Hence option B is correct.

The Chinese emperor, Zhu Di, sought to expand China's influence, showcase its power, and enhance its prestige by engaging in diplomatic missions and establishing tributary relationships with foreign states.

Maritime Trade: Zheng He's expeditions were also driven by the goal of expanding China's maritime trade network. The voyages allowed the Chinese to establish trade routes, acquire valuable goods, and promote economic growth by facilitating commerce with various countries across Asia, Africa, and the Indian Ocean region.

Display of Power and Prestige: Another objective of Zheng He's voyages was to demonstrate the might and grandeur of the Chinese Empire.

Learn more about Zheng He's voyages here

https://brainly.com/question/17293439

#SPJ2

what was the purpose of Zheng He's voyages? Choose three correct answers.

Exploration and Diplomacy

Power and Prestige

To establish trade routes and expand Chinese influence in the Indian Ocean region.

To spread Chinese culture and establish diplomatic relations with other civilizations.

To explore and gather geographical knowledge of distant lands.

Other Questions
The ________ measures the return on owners' (both preferred and common stockholders) investment in the firm.A) net profit marginB) price/earnings ratioC) return on equityD) return on total assets Which STEAL element does author Frances Hodgson Burnett use in this characterization from the story Sara Crewe: Or What Happened at Miss Minchins?Miss Minchin was tall, and had large, cold, fishy eyes, and large, cold hands, which seemed fishy, too, because they were damp and made chills run down Sara's back when they touched her.A. thoughtsB. actionsC. speechD. looks Which of the following benefits do member of Congress not receive?retirementsalaryimmunity from arrestallowance (6th grade math) yasiara has 3/4 of cake. she wants to divide it up into 1/12 size pieces. how many pieces will she have? ( can you show work please) Me gusta tocar ___________. can someone help meWhat is the missing numerator?blank over seven plus thirteen over fourteen equals one and three fourteenths (20 points) a11 b8 c5 d2 PLEASE HELP Ill give brainliest!!! What is the main idea in the woman in the snow? Someone pls help zoe has earned 650$ during the four weeks she worked at the rec center. the first 2 weeks she earned 220$ and 98$. the last 2 weeks she earned the same amount. how much money did zoe earn in the last 2 weeks What is the slope, m, and y-intercept for the line that is plotted on the grid? Triangles have a total of 180. Use the triangle below to determine the value of X. What are five ways companies target teens and vaping? What is the slope of the line that passes through the points (-8, 6) and (-5, -3) Find the product of 3 1/5 and 5/8. Express your answer in simplest form Which statement from The Number Devil best reveals that the author is using the number devil's character to promote a positive view of mathematics? "Most genuine mathematicians are bad at sums. Besides, they have no time to waste on them. That's what pocket plz help me plzzzzzzzzzzzzz Mother has purchased 75 yards of green fabric and 125 yards of white fabric to make green and white curtains. What is the largest number of curtains she can make if she wants all the curtains to be exactly the same length, and to have no fabric left over? How many yards of each kind of fabric would be used for each curtain? I believe it is AAS but am not sure whether ASA could be true as well What is the allele number for the following sequence? (3pts)GTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCA Which is a central idea of the text?