Write at least five questions you can ask during the open forum about the advantages and disvantages of k to 12 basic education curriculum

Answers

Answer 1

Answer:

Explanation:

Based on the current state of the basic education curriculum, I believe that the following questions target real world issues that the curriculums need to focus on.

How is grade k preparing children for the academic life?How is grade 12 preparing teenagers for an adult life, including college/career?What is being done to increase creativity among the students?Why aren't there any life skills classes such as filing taxes, interview preparedness, investment ideas, etc.?Why aren't student passions targetted at an early grade level and have curriculums developed around that passion?Why are curriculums different based on geographic locations and economic status of the students families?

I believe these questions would target all the advantages and disadvantages regarding the basic education curriculum and bring up interesting conversations.


Related Questions

What is the answer.Anyone can help me please. ​

Answers

Answer:

1. A

2. B

3. C

4. A

5. C

6. A

7. C

8. C

Explanation:

Determine whether the sentence below is correct or a run-on sentence.

Churchill, near Hudson Bay, is the gateway to the far North and the base
of many arctic expeditions.
a.
Run on
b.
Correct

Answers

Answer:B Explanation: I took the test and got it right.

Answer:

B; Correct

Explanation:

Select all that apply.

Which of these loses effectiveness if over-used?

heading
special type
bullets
tips and warnings
equipment lists

Answers

Answer:

bullets.....................

They often read emails to their phones
A. Active
B. Passive

Answers

Answer:

B

Explanation:

THE ANSWER OF THIS QUESTION IS B

B passive

The answer is passive

essay on my best teacher​

Answers

"Essay on MY best teacher" We do not know your teachers and you did not provide any valid information on them, nobody can help without more data and you should be doing this alone because we dont know them.

Mr. Shekhar is ........ Union leader.
options :
. an
. the
. a
.none of these

hurry will surely mark the brainlyest!! it's a a grammar question hurry ​

Answers

Answer:

Mr. Shekhar is the Union leader.

Explanation:

Will give brainliest!!!
What are the steps film makers use in storyboarding?

Answers

Answer:

Make a shot list.  

Sketch it out.  

Fill in details.  

Add words.

Explanation:

There are three light bulbs shown in the diagram. How
many of each additional component are shown?
O one battery, two switches, two resistors
O two batteries, three switches, two resistors
one battery, four switches, one resistor
O two batteries, three switches, two resistors

Answers

a

Explanation:

two battery two switches two resistors

the guy above is right just think about a normal light bulb system

please answer check your understanding:))​

Answers

Answer:

hi ... um..

Explanation:

sry.. tbh i really dont undrstnd ur ques...

(from The Strange Case of Dr. Jekyll and Mr. Hyde, by Robert Louis Stevenson)

Read the passage carefully and then answer the question.

Mr. Utterson the lawyer was a man of a rugged countenance that was never lighted by a smile; cold, scanty and embarrassed in discourse; backward in sentiment; lean, long, dusty, dreary and yet somehow lovable. At friendly meetings, and when the wine was to his taste, something eminently human beaconed from his eye; something indeed which never found its way into his talk, but which spoke not only in these silent symbols of the after-dinner face, but more often and loudly in the acts of his life. He was austere with himself; drank gin when he was alone, to mortify a taste for vintages; and though he enjoyed the theater, had not crossed the doors of one for twenty years. But he had an approved tolerance for others; sometimes wondering, almost with envy, at the high pressure of spirits involved in their misdeeds; and in any extremity inclined to help rather than to reprove. "I incline to Cain's heresy," he used to say quaintly: "I let my brother go to the devil in his own way." In this character, it was frequently his fortune to be the last reputable acquaintance and the last good influence in the lives of downgoing men. And to such as these, so long as they came about his chambers, he never marked a shade of change in his demeanour.

The word in bold is an example of what kind of tone?

A. upset.

B. afraid.

C. friendly.

D. excited.

Answers

I think it’s d but I might be wrong

Which statement best describes how the author addresses conflicting historical perspectives on Rasputin in the text?
A The author describes the controversy surrounding Rasputin without citing different perspectives on his life and death.
B The author presents contradictory accounts in order to show that historians know nothing about who Rasputin really was.
C The author only includes evidence that supports her assertions about Rasputin’s character and qualities.
D The author introduces different viewpoints in order to create a complex portrait of Rasputin.

Answers

Answer:

c

Explanation:

Choose the words to fill in the blank, which best complete the sentence. The piece above is called, The Portuguese, by Georges Braque. Braque used zigzag lines as his primary element in this piece, in order to suggest _____(1)_____ and _____(2)_____. a. (1) confusion; (2) action b. (1) depth; (2) vibrancy c. (1) dimension; (2) form d. (1) mood; (2) direction Please select the best answer from the choices provided

Answers

Answer:

a. (1) confusion; (2) action.

Explanation:

The oil on canvas painting "The Portuguese" by Georges Braque was a form of Cubist painting that the artist founded and introduced in 1911. This style of painting presents a dismembered, abstract image of an object, making it into a complicated, broken-up picture that viewers has to try hard to understand.

"The Portuguese" by Braque contains stencilled letters BAL on the top right side, with numerals under them. Though the letters and the numerals does not represent anything in particular, they were included by the artist for purely compositional purposes.

The painting used zigzag lines as his primary element to suggest confusion and action at the same time.

Answer:A

Explanation:

Helpmeeeeeeeeeeeeeeeeeeee

Answers

Answer:

1) I have gone to the library today.

2) You have kept a pet for three years.

3) Have you eaten Thaifood before?

4) Has it rained all day?

5) Who has we forgotten to invite?

6) We haven't heard that song already.

7) He hasn't forgotten his books.

8) She has stolen all tje chocolate!

9) Have I explained it well?

10) Who has he met recently?

what is the significance of the quote "If a journey doesn't have something to teach you about yourself, then what kind of journey is it?"

Please help!!

Answers

In the quote, “ To travel is to take a journey into yourself, by Danny Kaye, it talks about how a trip is a time to learn more about yourself. This means while you are on a voyage, you are actually learning about yourself, during the way. The quote message relates to Salak’s journey because she states that “ If a journey doesn’t have something to teach you about yourself, then what kind of journey is it?” 68-69 In Salak’s excerpt, The Cruelest Journey, her central idea is a journey is a search for the unfamiliar. I agree with her because while after you search for the unfamiliar you see your own life and try to fix the faults in it.Before, her life was always the same, “ Nothing seemed to change; nothing took on a new variety.” line 223-224 In detail, Salak was living a repetitive schedule that was imaginably boring. This was why she wanted to take on the challenge and risk everything to see what the world had to offer her. She wanted to discover how she could turn her life around. However, if the opportunity did not come to her, then she would be missing out on the greater gifts of life because she realized how she was living, after her journey. The voyage was a time of reflection and realization. To prove the statement, after Salak went on her expedition, she noticed that, “.. the world has altered over these past few weeks.”, in a subtle but certain way. 221 This shows that through her trip, her way of thinking altered in less than a month. She wants to live a life that is unexpected and full of dangers. Instead of a calm and mellow life

The quote means that a journey is only useful if there is something to teach that helps individuals to get to know each other better.

From reading the above quote, we can see that:

A journey is supposed to be something positive.The journey must be educational and bring about positive change.If the journey is not educational it is useless.If the journey does not teach the individual to understand himself, it should not be considered a journey.

This interpretation happens because a journey is an adventure full of challenges that must be overcome and that enhances the individual to overcome their fears, difficulties and understand themselves and the world around them.

You can find more information at the link below:

https://brainly.com/question/20779259?referrer=searchResults

which sentence uses a third-person point of view
A: sure, randy was going off to Harvard, but what would happen to the rest of us

B: "watch out for that bucket!" Mina shouted, and pushed me out of the way.

C: impossible. How could she already be inside? Cabot shook his head in disbelief.

D: Myself, i don't much care for cacti or fungi when it comes to decorating​

Answers

Answer:

C

Explanation:

the rest seem to be like 2nd person and 1rst person

Answer:

Letter C - impossible. How could she already be inside Cabot shook his head in disbelief.

Explanation:

The sentence for letter C uses the third person point of view because it uses the pronouns she and his which would fall under the third person point of view category.

why are legacies important?

Answers

Answer:

legacy is about making an impact that is meaningful and outlasts us.

Explanation:

If legacy is done well, generations later your efforts, creativity, insights, vision, values and wisdom make a valuable contribution to how people are able to live their lives. If those who benefit are your grandchildren and great grandchildren, that is wonderful.

seema tells a joke passive voice​

Answers

Answer:

A joke was told by Seema.

Explanation:

In the rewritten passive sentence above, Seema who was the subject of the given sentence becomes the object. This is how passive sentence are phrased. Instead of the subject to perform an action on the object, the subject rather receives the action and the object assumes the position of the subject.

Therefore, while the first sentence- "Seema tells a joke," is in the active voice, the sentence, "A joke was told by Seema," is in the passive voice.

I NEED HELP PLEASE AND PLEASE DONT PUT ANSWERS THAT HAVE NOTHING TO DO WITH WHAT IM ASKING PLEASE PUT THE CORRECT ANSWER I WILL GIVE BRAINLIEST TO WHOEVER IS THE BEST ANSWER
Act 1 Scene 1 Writing Assignment


After reading Act 1 Scene 1 in Romeo and Juliet and reading the summary chart below, explain how the following pairs see one another/think of one another. Use character names and lines and citations from the Middle English version of the play for clarity


Montagues vs. Capulets

The Prince vs. the fighting between the two families

Benvolio vs. Romeo



Summary of Act I scene i:


Setting, a street in Verona, ItalyIn Act I scene i of Romeo and Juliet, Shakespeare sets up the rivalry between the families of Romeo and Juliet. Romeo’s family is the House of Montague and Juliet’s family is the House of Capulet.
Two servants from each House meet on the street in Verona, Italy. They argue and trade insults about each other’s Houses. A fight ensues. Benvolio, Romeo’s cousin, draws his sword to stop the fight. Tybalt, Juliet’s cousin, sees Benvolio’s sword drawn and draws his sword.
The fight grows as other people join in. Finally, the Prince breaks up the brawl. He is tired of the feud between the Montagues and Capulets.


The scene ends with the Montagues, Romeo’s parents asking Benvolio if they have seen Romeo lately. Benvolio sees Romeo in the distance and tells his parents he will find out what is wrong with him.

Answers

Answer:

i think its b sorry if its not

Explanation:

Answer:

Romeo dies

Explanation:

His love for Juliet killed him. May he rest in peace.

PLEASE HELP
1.
a nobleman who wants to marry Juliet
2. adversary to Romeo
3. banished from Verona
4. devises a plan for Romeo and Juliet to be together
5. Juliet's cousin
6. performs Romeo and Juliet's nuptials
7. plays messenger for Juliet
8. Romeo's good friend
9. tells Romeo that Juliet is dead
10. the setting of Romeo and Juliet
11. threatens to disown Juliet
12. tries to make peace with Tybalt

Answers

Answer:

1.paris

2.

3.romeo

4.friar Lawrence

5.tybalt

6.friar Lawrence

7.nurse

8.benvolio

9.balthasar

10.verona

11.lord capulet

12.benvolio

I need help writing option A

Answers

12-13(567)x 367 is the answer

A profit of R99 360 was made at a music concert. It was shared in a ratio of
2:1 to Nelson Mandela's Children's Charity. How much of the profit did the
charity receive?​

Answers

Answer:

umm its gonna be 10

Explanation:

In the movie Thor (2011), Thor and his brother Loki physically battle for the throne. Which term describes the conflict best?

Answers

The movie si a dvd and my A si the beta

In "Broken Chain,” Alfonso tries to straighten his crooked teeth. Which verb from the passage is the most repetitive for describing his efforts?


Answers

push is the most repetitive word for describing his efforts

Answer:

B.

Explanation:

What was the purpose of the Gettysburg Address?

Answers

Answer:

Lincoln's main purpose was to urge everyone to honor those who had died at Gettysburg by striving to maintain the kind of nation imagined by America's founders. President Lincoln delivered the Gettysburg Address on November 19, 1863.

Explanation:

Hope it may help you..!

Anna asked her mother if she could drive the car to the store herself. Anna's mom said, "Sure, ten-year-olds drive themselves to the store all the time!" What kind of irony is used in this story?

Answers

Verbal Irony

Verbal Irony occurs when a speaker's intention is the opposite of what he or she is saying.

Anna’s mom said that ten year-olds drive thenselves to the store all the time. When in reality, we all know this is false. Young children cannot drive themselves anywhere.

Hope this helps!

Which passage most clearly contains imagery?
O A. "Don't say another word!" Gina shouted.
B. The odor of rotten eggs wafted from within.
C. He suspected. He knew. He saw. He smiled.
D. First, call our hotline. Next, work out a plan.
SUBM

Answers

b. the odor of rotten eggs reacted from within.

Read the excerpt from Animal Farm and the passage on the history of the Soviet Union. On the third Sunday after Snowball's expulsion, the animals were somewhat surprised to hear Napoleon announce that the windmill was to be built after all. He did not give any reason for having changed his mind, but merely warned the animals that this extra task would mean very hard work, it might even be necessary to reduce their rations. The plans, however, had all been prepared, down to the last detail. A special committee of pigs had been at work upon them for the past three weeks. The building of the windmill, with various other improvements, was expected to take two years. That evening Squealer explained privately to the other animals that Napoleon had never in reality been opposed to the windmill. On the contrary, it was he who had advocated it in the beginning, and the plan which Snowball had drawn on the floor of the incubator shed had actually been stolen from among Napoleon's papers. In November 1927, Joseph Stalin launched his "revolution from above” by setting two extraordinary goals for Soviet domestic policy: rapid industrialization and collectivization of agriculture. His aims were to erase all traces of the capitalism that had entered under the New Economic Policy and to transform the Soviet Union as quickly as possible, without regard to cost, into an industrialized and completely socialist state. Stalin's First Five-Year Plan, adopted by the party in 1928, called for rapid industrialization of the economy, with an emphasis on heavy industry. It set goals that were unrealistic—a 250 percent increase in overall industrial development and a 330 percent expansion in heavy industry alone. All industry and services were nationalized, managers were given predetermined output quotas by central planners, and trade unions were converted into mechanisms for increasing worker productivity. Many new industrial centers were developed, particularly in the Ural Mountains, and thousands of new plants were built throughout t

Answers

Answer:

whats the question

Explanation:

Marijuana and teens facts to put in my essay?

Answers

Answer: Most teens start marijuana as a young kid

Explanation: young kids start smoking early.

Someone help me please

Answers

Answer is B.

Hope it helps

Question 22 of 24
What would be the effect of including details from daily life in South America
in a story?
The story would appeal more to readers outside of South America.
B. The story would feel realistic to a South American reader.
C. The story would remind readers of the conflict between religions.
D. The story would have a more somber tone.
O
SUSM

Answers

Answer:

D THE STORY would have a more somber tone

Other Questions
Express this sense sequence as a polypeptide. Use the three letter abbreviation and separate the amino acids with a dash - e.g. Trp-Thr-Ala. If there is a stop codon - you may add an asterisk to the sequence - e.g. Trp-Thr-Ala-* ATTTTAGCCATGCCCGGGAAAATACGCCGCCCTCCCGGTACACCATTGTTCGGCAAATAAAAATAAAAT polypeptide sequence [answer1] what is the DNA sequence of the 5' UTR? [answer2] what is the RNA sequence of the 3' UTR [answer3] What transformation(s) were made to the original f(x) = x3 graph?The function was shifted to the right 3 units.The function was shifted to the left 2 units.The function was stretched by a factor of 2.The function was shifted to the right 2 units.The function was shifted upward 2 units.The function was stretched by a factor of 0.5. What does this mean anyone? Some guy sent it to me and Im having trouble translating it Give an example of a composite number written as a product of primes.Choose the correct answer below.A. 60 = 2 x 2 x 15 or 60 = 22 x 15B. 41 = 1x41C. 28 = 2x2x7 or 28 = 22x7 compare and contrast the Nationalist Party with the Chinese Communist Party. Can you guys help me find the answer PLZ HELP ASAP!!!!!!!!!!!!!! A store has two different coupons that customers can use. One coupon gives the customer $15 off their purchase, and the other coupon gives the customer 30% off of their purchase. Suppose they let a customer use both coupons and choose which coupon gets applied first. For this context, ignore sales tax.Let f be the function that inputs a cost (in dollars) and outputs the cost after applying the "$15 off" coupon, and let g be the function that inputs a cost (in dollars) and outputs the cost after applying the "35% off" coupon. a. Suppose acustomerwants to purchase asi 40 item and apply the si 5 of coupon first, and then the 35% or coupon How much will the item cost after applying the coupons?b. Suppose a customer wants to purchase a S 140 item and apply the SI 5 off coupon first, and then the 35% or coupon Ure ction notation to represent how much the item will cost (dollars) after applying the coupons. c. Suppose a customer wants to purchase a $140 item and apply the 35% om coupon first and then the sis of coupon How much will the item cost after applying the coupons?d. Suppose a customer wants to purchase a S 140 item and apply the "35% or coupon first and then the "S 15 off coupon. Usefu ction notation to represent how much the item will cost (dollars) after applying the coupons. Population, 1860-1920Year Percent Rural Percent Urban186080.219.8187074.325.7188071.828.2189064.935.1190060.439.6191054.445.6192048.851.2Which of the following statements is TRUE about the information displayed in thetable above?Between 1860 and 1880, rural population increased.Between 1860 and 1920, people began moving to cities.Between 1910 and 1920, rural and urban populations were even.D Between 1860 and 1920, urban and rural populations remained stable. A corporation declares a cash dividend on Friday, December 5th, payable to holders of record on Friday, December 19th. The local newspaper publishes the announcement on Monday, December 8th, while Standard and Poor's reports the dividend on Friday, December 12th. The ex date for regular way trades will be set at: A Friday, December 5th B Wednesday, December 17th C Thursday, December 18th D Friday, December 19th our situation is ____ to the problems the warehouse staff dealt with last year. analogous, opposite, incongruous, conducive, symmetrical Please help, show work! Limits and functions! 85 points! Answer for fee rbux and branlest!!!! i need answer NOW or i will be DIE (not good!!!) 61 1/20 as a decimal The length of a rectangle is six times its width.If the perimeter of the rectangle is 84 in, find its area. what is the range of 20,15,10,5 Find the approximate surface-area-to-volume ratio of a bowling ball with a radius of 5 inches.A 0.6B. 0.67C. 1.67D. 25 A bakery celebrated its 25th anniversarylast Friday. On that day, every 12thcustomer received a free loaf of breadand every 9th customer received a freecupcake.Lauren was the first customer to receivea free loaf of bread and a free cupcake. What was Lauren's number? please help with the steps How would I figure this out?