Answer:
UUUUUUAAAAAAGGGCCCCAAAUAUAUAG
Explanation:
All you have to do is apply the same concept as DNA, but T (Thymine) is replaced with U (Uracil)
Can you tell me which go where?
Answer:
heredity goes to the first one
phenotype at the second one
Explanation:
Overgrazing reduces grass cover and negatively impacts the soil health by reducing it's ability to hold water . How can Overgrazing be prevented and support a more sustainable use of grasslands ?
A. Allow developers to buy rachlands for housing .
B. practice moving confined cattle every few days
C. Allow unlimited animals to graze in a given area to reach carrying capacity.
D. practice grazing an area of land at the same stage of plant growth each year .
Answer: C. Allow unlimited animals to graze in a given area to reach carrying capacity.
Explanation: I choose this as the answer because the animals grazing in the wrong parts be part of the reason the soil can't hold the water it needs, so allowing animals in a particular area that's less of a problem with Overgrazing would be helpful
i know its not a study question but if deaf peopke dont know what people sound like how do think in their head
Answer:
deaf people can think and know thier voice when they are thinking so they don't rlly need to imagine peoples voices they know what people would soundlike but some people aren't born deaf and know how people sound like
Explanation:
Answer:
Well.. they have their own voice that they can be able to hear in their head... it's given automatically, the voice they hear when they talk. It's not something where the first voice you hear in your life, is the one you hear for the rest of ya life..
Explanation:
Hope this helped :D Have a great day
QUESTION: Which one of the following is likely to be most effective in reducing dental decay?
(a) Eating fibrous food, e.g. apples, after meals.
(b) Cutting down on sweets, biscuits etc. between meals.
(c) Cleaning the teeth after meals and at night.
(d) Using an antiseptic mouthwash.
help me plz
Answer:
It is between B and C I am 99.999% Sure its C but you might wanna check :))))
Explanation:
All planets in the solar system have surfaces that are made up of either one of two materials. What are the two materials?
Answer:
are made of rock, containing common minerals like feldspars and metals like magnesium and aluminum.
Explanation:
Atmospheric nitrogen, in its gaseous form, is useful to plants. *
True
False
Answer:
true
Explanation:
Answer:
False.
Explanation:
Atmospheric Nitrogen, in its gaseous form, is harmful to Plants and Animals.
Have a great day! (:
Which component of a galaxy consists of tiny particles that look smoky or cloudy and can be found in the space between stars? A) Gas B) Stars C) Dust D)Sun
Answer: Gas
Explanation:
Look through the lesson lol i know your school
Nebulae are different luminous regions of the interstellar medium that can be made up of cosmic dust as well as ionized, neutral, or molecular hydrogen, hence option C is correct.
What is dust?All the stuff between stars is referred to as interstellar matter by astronomers, and the complete collection of interstellar matter is referred to as the interstellar medium (ISM). Some interstellar material is gathered into massive clouds that are each referred to as a nebula.
Tiny pieces of solid matter drifting about in the region between stars make up cosmic dust. It's not like the dust you find in your home; instead, it has tiny particles that range in size from collections of just a few molecules to grains that are 0.1 mm in size.
Therefore, an interstellar medium can be made up of cosmic dust as well as ionized, neutral, or molecular hydrogen, hence option C is correct.
Learn more about the dust, here:
https://brainly.com/question/562915
#SPJ6
Need help right nowwww!!
Osmosis is important to cells because _______ *
cells contain fluids that are mostly water
cells are filled with fluids that are mostly sugar
cells need to be kept cool
cells need food
( PLEASE ANSWER THIS ASAP!!!) Thanks!!
Answer:What is the main function of osmosis? Osmosis helps in stabilizing the internal environment of the organism by balancing the levels of water and intracellular fluids. Also, the nutrients and minerals enter the cell by osmosis which is necessary for the survival of cells.
Explanation:
Osmosis maintains the osmotic pressure in cells. the answer to this question is options A and B.
Osmosis is essential for the cells due to two reasons:
1. Cells are made up mostly of water-based fluids. The process of osmosis involves the movement of water molecules from a region with a lower concentration of solutes to an area with a greater concentration of solutes through a semipermeable membrane. This aids in preserving the equilibrium of water within and outside the cell, ensuring that the cell remains hydrated and performs as intended.
2. Sugar-based fluids are the main component of cells' fluids. Osmosis also affects how much sugar and other solutes are present inside cells, helping to control their concentration. Osmosis will cause water to enter the cell if the concentration of sugar inside the cell is higher than the outside, diluted the sugar, and maintain equilibrium.
Therefore the correct answer is options a and b.
Learn more about osmosis here:
https://brainly.com/question/31028904
#SPJ6
Will give the brainiest! Please answer it correctly and thoughtfully. Please answer the first question with AT LEAST 2-3 sentences, while the last one can just be examples
1. Meiosis is two divisions of a reproductive cell’s nucleus. It occurs in a continuous series of steps. Compare AND contrast the steps of meiosis I to meiosis II.
2. Describe mutation. Give EXAMPLES where mutations could be harmful, beneficial, or neutral.
Answer:
1. Both Meiosis I and II have the same number and arrangement of phases: prophase, metaphase, anaphase, and telophase. In meiosis II, these chromosomes are further separated into sister chromatids. Meiosis I includes crossing over or recombination of genetic material between chromosome pairs, while meiosis II does not.
2. Answer! A Mutation occurs when a DNA gene is damaged or changed in such a way as to alter the genetic message carried by that gene. The majority of mutations are neutral in their effects on the organisms in which they occur. Beneficial mutations may become more common through natural selection. Harmful mutations may cause genetic disorders or cancer. I hope it helps! :)
4. Transcribe and Translate a Gene. How is mRNA different from DNA? (Hint read the side-bar on this page for help) What is the correct starting position for translation? Write the amino acids used to assemble your protein in the order below. Where does translation take place?
Which is most likely the last to form
Which of the following are sources of extra nutrients that can cause algae to overgrow in water due to HUMAN activity? CAREFULLY select all options that apply
dissolved oxygen in water
treated waste water
viruses
combined sewage overflow (CSO)
fertilizers
cleaning products
dog poop on the streets of NYC
water running over rocks
(This is 7th grade sciencve).
Answer:
Too much nitrogen and phosphorus in the water causes algae to grow faster than ecosystems can handle. Significant increases in algae harm water quality, food resources and habitats, and decrease the oxygen that fish and other aquatic life need to survive.
hopes this helpssssssssssssssssssssssssssssssssssss
What is the difference between a molecule and a diagram of a molecule ?
Answer: The molecule itself is the actual thing present.
while the diagram explains what makes up a molecule or what it looks like structurally
Explanation:
What is the function of mitochondria in prokaryotes?
Answer:
Prokaryotes lack mitochondria.
QUICK PLS
Body cells have
____ the number of chromosomes as sex cells.
a: 4times
b: one half
c: one fourth
d: twice
Answer:
Body cells have twice the number
:-) :-) :-) :-) :-) :-) :-) :-) :-)
Please help
Answer:
.
Explanation:
At which type of technonic plate boundary is a volcano least likely to occur
Answer: A
coz its just sliding one another
Hope it is correct
^_^
In C3 cycle one carbon compound is accepted by?
Answer:
The correct answer is - RuBP.
Explanation:
In calvin cycle or C3 cycle there is only one carbon compound present or enter in the cycle is carbon dioxide which is enters through stomata and move into stoma of chloroplast. It is the site of of the C3 cycle.
In calvin cycle energy used to reduce 3-phosphoglyceric acid to produce glyceraldehyde-3 phosphate which result in generation of the RuBP that accepts the CO2 from the air to attached with RuBISCO.
What does the lunar rover do?
O moves astronauts around
O gives air to astronauts
O makes space rocks
Which of the following is a synthetic material?
a. wood
b. plastic
c. wool
d. coal
Answer:
Your answer is B) Plastic.
Explanation:
"Synthetic" just means "human-made" or "artificial".
A), C), and D) can all be found in nature, and aren't made by humans.
Give three differences between parenchyma and selerenchyma?
Answer:
Parenchyma cells have thin primary walls and usually remain alive after they become mature while Sclerenchyma cells have thick lignified secondary walls and often die when mature.
Parenchyma forms the "filler" tissue in the soft parts of plants while Sclerenchyma provides the main structural support to a plant.
Parenchyma cells are usually loosely packed with large intercellular space while Sclerenchyma cells has no intercellular spaces between the cells.
Of all of the energy given off by the Sun directed towards Earth, approximately only 50 percent of the energy penetrates directly to
the surface of Earth. What is the best explanation for what happens to the rest of the energy?
A) Energy is lost during while traveling through space.
B) Energy is reflected or absorbed by Earth's atmosphere.
C) Some of the energy is reflected back into space by the Moon.
D) Energy is lost through the process of overcoming the Sun's large gravitational force.
While the average human is able to hold his or her breath for approximately one minute, a whale can dive for over 30 minutes without returning to the surface. Which of the following correctly describes this difference? (4 points)
Whales need less energy than humans.
Whales gather energy from their environment better than humans.
Whales are more efficient at gas exchange than humans which helps them conserve energy.
Whales have cells that produce energy differently than humans.
Answer:. I guess it's b because we know that whales have a blowhole hope this helps
Can someone please help ASAP
Answer:
I would say 2/4 or 3/4 sorry if its wrong
4. If we had a waxing crescent moon on December 3, what phase will be seeing on December
13 (10 days later)?
Answer:
Waxing gibbous
Explanation:
Will lactase, the enzyme that digested the ice cream's lactose, also work on the lactose found in cheese?
Answer:
Yes
Explanation:
This is because lactose found in any dairy product will always have the same molecular structure. The lactase enzyme breaks down lactose because of how it is structured, so it does not matter where the lactose comes from.
Which is the most efficient way to avoid DNA mutations from UV radiation?
Avoid getting X-rays at the doctor’s office.
Avoid protective shields during X-rays.
Avoid UV radiation by wearing sunscreen.
Avoid UV radiation by using a tanning bed.
Answer:
Sunscreen is the best, and most efficient way to avoid DNA mutations. UV radiation causes thymine dimers in the DNA complex, so limiting UV radiation is key to avoiding DNA mutations.
Explanation:
The most efficient way to avoid DNA mutations from UV radiation is to avoid UV radiation by wearing sunscreen. Thus, the correct option is C.
What is DNA mutation?DNA mutation may be defined as the process that induces sudden, stable, and inheritable changes in the genetic material of organisms through various factors.
The UV radiations are the most potent physical agent that induces DNA mutation. But in order to avoid such kinds of DNA mutations from UV radiation one must be required to be protected from such kinds of harmful radiation with the help of sunscreen.
The UV radiation induces DNA mutations by causing the dimerization of the thymine base, which significantly alters the whole sequence of genetic material.
Therefore, the most efficient way to avoid DNA mutations from UV radiation is to avoid UV radiation by wearing sunscreen. Thus, the correct option is C.
To learn more about DNA mutations, refer to the link:
https://brainly.com/question/994615
#SPJ6
How can the health of a forest play a role in maintaining human health?
A. Forest can be a source of mining.
B. Forest provide pulp to make paper.
C. Medicines are made from forest species.
D. Forest provide numerous wildlife habitats.
Answer:
C. medicine can be made from different sources in the forest
Which human activity negatively affects the stability of the environment?
Answer:
Some human activities that cause damage (either directly or indirectly) to the environment on a global scale include population growth, overconsumption, overexploitation, pollution, and deforestation, to name but a few.
Explanation:
Brainliest?