Your teacher will grade your responses to questions 24 and 25 to ensure you receive proper credit for your answers. Identify the systems that move your body, and explain how these systems work together.

Answers

Answer 1

Answer: Nervous system, skeletal system, muscular system. The nervous system control the muscles and the skeletal system helps to support those muscles.

Explanation:

The nervous system consists of a set of cells specialized in conducting electrical and chemical signals, called neurons, and glial cells that are supportive. The nervous system picks up external stimuli from the environment or signals from the organism itself (internal stimuli), and this information is transmitted by nerves to the brain, where everything is processed and a signal is emitted that causes the contraction of certain muscles.

The nervous system is divided into central and peripheral systems. The central nervous system comprises the spinal cord and brain, while the peripheral nervous system comprises the nerves that connect the central nervous system to the body. Within the peripheral nervous system, there is a sensory (afferent) nervous system responsible for incorporating information from receptors (such as the eyes, the skin for touch, etc.), and a motor (efferent) system that carries the information to the muscles.  

From the functional point of view, it is also differentiated into somatic and autonomic system. The somatic nervous system consists of neurons that control voluntary actions, while the autonomic nervous system is responsible for involuntary functions. And within the latter group are included the sympathetic nervous system (which is activated in situations of danger to stimulate many organ functions that cause a rapid response), the parasympathetic (which is involved in the regulation of several organs and its action is opposite to that of the sympathetic nervous system) and the enteric nervous system in the gastrointestinal tract.  

The muscular system is a set of muscles that can be controlled voluntarily, if we refer to skeletal muscles. Their main function is mobility, an action that takes place when stimuli from the nervous system provoke the contraction of the muscle fibers. There are three types of muscle tissue: skeletal, smooth and cardiac, and all of them are able to contract but they differ in certain characteristics, location and the way in which the contraction is regulated, which can be voluntary or involuntary.  

Muscle tissue receives electrical impulses from the nervous system and responds to them by generating a contraction movement. The neuromuscular junction plate is the connection established between a motor neuron and a muscle, by means of which the neuron transmits electrical impulses to the muscle fiber and between them there is a space called synaptic cleft. When a nerve impulse called action potential travels through the axon of a motor neuron, the neurotransmitter acetylcholine is released into the synaptic cleft, which binds to the muscle cell membrane and causes it to alter its membrane potential causing a depolarization that triggers contraction.  

Finally, the skeletal system consists of a rigid structure formed by bones, and has several functions such as mechanical support, maintenance of posture, makes possible the bipedal position and protection of vital organs. The joints between two adjacent bones, called articulations, make muscular movements possible. In addition, the bones serve as insertion sites for the tendons of the muscles, which allow movement that is controlled by the nervous system and carried out mainly by the muscular system.

So, the nervous system control the muscles and the skeletal system helps to support those muscles.


Related Questions

do you think it is right for people to keep animal's in their homes?​

Answers

Answer:

There are many health benefits of owning a pet. They can increase opportunities to exercise, get outside, and socialize. Regular walking or playing with pets can decrease blood pressure, cholesterol levels, and triglyceride levels. Pets can help manage loneliness and depression by giving us companionship.

Answer:

Yes,just yes no explanation

5.
Name three factors that may affect the carrying capacity of the population. (3 points)

Answers

Carrying capacity, or the maximum number of individuals that an environment can sustain over time without destroying or degrading the environment, is determined by a few key factors: food availability, water, and space.

I hope this helped.

Tara, a server, has a sore throat. She takes her temperature and it reads 100°F. She should be _____.


excluded from work

allowed to continue her duties as long as she does not start to feel worse

reported to the health department

restricted from working with food

Answers

Excluded from work because there’s risk of getting someone else sick and I think cross contamination

What is the main function of the central nervous system ? E2020

Answers

Answer:

The central nervous system (CNS) controls most functions of the body and mind. It consists of two parts: the brain and the spinal cord. The brain is the center of our thoughts, the interpreter of our external environment, and the origin of control over body movement.

Explanation:

Answer:

Main function-the interpreter of the environment and  control over body movement.

The central nervous system controls the body and mind. It has two parts, the brain and the spinal cord. The brain is the center of thoughts..

Compare photosynthesis and cellular respiration. In what types of cells do these processes occur?

Answers

Answer:

Cellular respiration occurs in both plants and animals.

But photosynthesis occurs only in plants. But photosynthesis can happen to 4 animals. It is only an exception, however. Sea slug and pea aphid may perform photosynthesis, oriental hornet, spotted salamander.

Explanation:

ATP is the main energy source of the cell. The most important final product of cellular respiration.

       The two main final photosynthesis products are glucose and oxygen.

Some of the cellular respiration enzyme reactions occur in the cytoplasm but the bulk is in the mitochondria. Inside the chloroplast, photosynthesis occurs.NADH is the high-energy cellular respiration electron carrier, while NADPH is photosynthesized as a powerful electron carrier.

In the cell chloroplasts, photosynthesis is carried out. This process gives energy directly or indirectly to all living organisms. Life on Earth would be no longer there without it.

Although photosynthesis needs energy and produces food, cellular breathing breaks food down and releases energy. Photosynthesis and respiration are carried out by plants while animals can only breathe.

Which statement is true about gene expression? Give brainlist is answer right

Cells become specialized because different cells contain different sets of genes

Gene expression occurs primarily when DNA is replicated before the process of mitosis
The DNA of repressed genes gets destroyed because it is not being used

A cell becomes specialized by controlling the which proteins are produced from the cell's DNA

Answers

Answer:

I guess All of them

Explanation:

Gene expression has all of these statements as given above in text.

what is the smallest unit of DNA molecule that can be altered by a mutation and cause a change to the coding of polypeptide

Answers

Nucleotide is the smallest unit of DNA molecule that can be altered by a mutation and cause a change to the coding of polypeptide.


Which features form along all types of plate boundaries?
Hurry up!!

Answers

Explanation:

Ocean ridges features form along all types of plate boundaries.

Graduate students monitoring the benthic organisms of a freshwater lake take samples at different depths throughout the lake and identify the invertebrate species present. In a deep region of the lake, they discover a crustacean that appears to be a new species. They decide to study its natural history. What is the first thing they should do in this study?

Answers

Answer:

Do a literature search to find natural history information on closely related species.

Explanation:

In the context,  few graduate students monitored the benthic organisms from the fresh lake water samples and identified the invertebrate species that are present.

They also discover a crustacean which appears to be the new species for which they decided to do a study on its natural history. The first thing that the graduate student should do is to do a literature search for finding a natural history on the information that are closely related species.

Nancy visits a local reservoir where she feeds ducks and other birds. Every time she feeds them she notices that they fight for the best pieces and some do not get any. All living things struggle to get the necessary amount of food, water, and shelter. What is the term for this struggle?

A. overproduction
B. natural selection
C. variation
D. competition

Answers

i think its competition

which of the following involves mitotic cell division.
a. production of a fertilized egg
b. sexual reproduction
c. asexual reproduction
d. production of gametes

Answers

C asexual reproduction

1. Written additive inverse of
a. 2/5
b.-6/9​
2 .find the multiple inverse of
a. 1/2
b. -3/4
c. 0
d. 9/5
e. 1
pls answes me this all

Answers

1. A. -2/5
B. 6/9

2.a. 2
B. -4/3
C.0
D.5/9
E1

Express this sense sequence as a polypeptide. Use the three letter abbreviation and separate the amino acids with a dash - e.g. Trp-Thr-Ala. If there is a stop codon - you may add an asterisk to the sequence - e.g. Trp-Thr-Ala-* ATTTTAGCCATGCCCGGGAAAATACGCCGCCCTCCCGGTACACCATTGTTCGGCAAATAAAAATAAAAT polypeptide sequence [answer1] what is the DNA sequence of the 5' UTR? [answer2] what is the RNA sequence of the 3' UTR [answer3]

Answers

Answer:

- Protein sequence: Met-Pro-Gly-Lys-Ile-Arg-Arg-Pro-Pro-Gly-Thr-Pro-Leu-Phe-Gly-Lys-*

- DNA 5' UTR: ATTTTAGCC

- RNA 3' UTR: UAAAAAUAAAAU

Explanation:

Transcription is the process in which a DNA sequence (e.g., a gene) is used as template (transcribed) in order to synthesize an RNA molecule, usually a messenger RNA molecule, which is then used as template to produce a polypeptide sequence (protein) in the ribosomes. In RNA, Thymine (T) bases are always replaced by Uracil (U) bases. An mRNA strand is formed in the 5′ to 3′ direction. Each triplet of nucleotides is referred to as a codon and the resulting mRNA strand is translated starting from codon AUG (Methionine), while there are three different stop codons or 'or termination codons' in the genetic code that terminate translation: UAG, UAA, and UGA.

If a plant develops a toxin, how
might a herbivore evolve in
response?
A. The herbivore will most likely change its diet.
B. The herbivore will eat the plant until it
becomes immune.
C. The herbivore will gradually evolve a
resistance.

Answers

Answer:

a

Explanation:

It will probably change it's diet

Answer: A the herivabore will change its diet unless the plant in question is a fundamental key to its survival that C the herbivore will gradually evolve a resistance but the answer would be A as this is not explained in the question.

I have no clue and the internet doenst help

Answers

Answer:

Soda

Explanation:

These are some weird questions...

I would say the canned soda since machines do most of that work anyway, while things like livestock need more human interaction, meaning more work needs to be done.

Investiga un uso beneficioso (medicina o industrial) para las bacterias, virus y Hongos microscópicos. Explica brevemente su utilización.

Answers

Answer:

- Hongos: antibiótico penicilina

- Bacterias: producción de insulina para uso humano

- Virus: vectores basados en adenovirus para el desarrollo de vacunas  

Explanation:

Los microorganismos son fundamentales para el desarrollo de diferentes tipos de aplicaciones industriales y medicinales. Por ejemplo, la penicilina es una sustancia sintetizada por el hongo Penicillium notatum, la cual es ampliamente utilizada como antibiótico debido a sus propiedades antibacterianas. Las penicilinas son antibióticos del grupo de los betalactámicos que tienen como núcleo un anillo central de beta-lactama, las cuales son capaces de destruir una amplia variedad de bacterias​. Por otra parte, las bacterias pueden ser usadas para la generación de moléculas orgánicas con fines médicos. Por ejemplo, cepas de Escherichia coli han sido modificadas mediante técnicas de ingeniería genética con el objetivo de producir insulina humana, una hormona central en el metabolismo de la glucosa. Mediante técnicas de recombinación genética, el gen responsable por sintetizar insulina humana ha sido introducido en bacterias. Las cepas de E. coli son relativamente fáciles de cultivar en el laboratorio y por lo tanto permiten obtener grandes cantidades de esta hormona (insulina). Finalmente, existen ciertas tipos de virus inocuos para nuestro organismo los cuales han sido recientemente utilizados como vectores para el desarrollo vacunas. Mediante esta técnica de ingeniería genética, un determinado vector viral (por ejemplo, un virus de la familia de los adenovirus) es modificado genéticamente con el objetivo de insertar un fragmento de un agente infeccioso o 'antígeno' el cual individualmente es incapaz de producir daño. Las vacunas diseñadas a partir de vectores virales son inofensivas para el organismo pero son capaces de desencadenar una respuesta inmune contra el antígeno recombinante, generando de este modo una memoria inmunitaria en contra el agente infeccioso.

Why do cellphone service providing firms often charge higher price to pre paid clients than those on contracts ​

Answers

Answer:

Name one waste substance the coronary veins will remove.

…………………………………………………………………………………………………..……………………

A student combined equal amounts of two solutions one solution has a pH of 2 and the other has a pH of 12 which would most likely be the resulting pH? 1,3,6,11

Answers

Answer:

It would be 6

Explanation:

Because high hydrogen concentration plus high hydroxyl concentration forms a neutral solution.

Proteins secreted by Gram-negative cells face multiple obstacles, including _____. Multiple choice question. moving across the periplasmic space underlying the thick peptidoglycan layer of the cell wall moving across the plasma membrane moving across the plasma membrane and the thick peptidoglycan layer of the cell wall moving across both the plasma membrane and the outer membrane

Answers

Answer:

moving across both the plasma membrane and the outer membrane

Explanation:

Gram-negative bacteria are bacteria that have a plasma membrane, a thin peptidoglycan layer, and an outer membrane (the space between the plasma membrane and the outer membrane is known as periplasm). Moreover, Gram-positive bacteria exhibit neither outer membrane nor periplasmic space and are surrounded by thick layers of peptidoglycan. Gram-negative bacteria have developed different protein secretion systems (types I–VI and type VIII) in order to secrete proteins into the extracellular space. For such purpose, the XcpQ protein (which is an outer membrane protein from the secretin family) participates in different transport processes in Gram-negative bacteria.

Which student provides the best explanation of how to determine whether Cell A or Cell B is a plant or animal cell? Rusty- "cell A is an animal cell because it contains more organelles than a plant cell, Cell B" Kristin- "Cell A is a plant call because it has large vacuole in the middle of the cell to provide support, structure, and storage for the cell" Darryl- " Cell B is an animal cell because it has nucleus" Eleanor- " Cell B is a plant cell because is has a larger cytoplasm then cell A which stores a plants water and minerals."

Answers

Answer:

Kristin's answer is the best.

Explanation:

It is the only correct answer.

The student that best explains whether Cell A or Cell B is a plant or animal cell is Kristin who said that "Cell A is a plant call because it has large vacuole in the middle of the cell to provide support, structure, and storage for the cell".

Distinctive features of plant and animal cells

Cell is the structural and functional unit of the living organism which contains organelles that carry out specific functions.

The plant cells can be distinguished from an animal cell through the following features:

it possess a larger vacuole which is centrally placed and helps in the storage of cell wastes.

It possess cellulose cell wall that provides support and structure to the cell.

They also possess chloroplasts which are not seen on animals cells.

Therefore, the student that best explains whether Cell A or Cell B is a plant or animal cell is Kristin who said that "Cell A is a plant call because it has large vacuole in the middle of the cell to provide support, structure, and storage for the cell".

Learn more about cells structure here:

https://brainly.com/question/6350862

how can a mutation in a gene affect the traits an organism has

Answers

Answer:

Genetic variations that alter gene activity or protein function can introduce different traits in an organism. If a trait is advantageous and helps the individual survive and reproduce, the genetic variation is more likely to be passed to the next generation (a process known as natural selection).

Explanation:

hope this helps...........

Answer:

The gene will code for a different protein than it should.

Explanation:

Can someone pls answer these multiple-choice questions, will mark as brainliest.

Answers

Awnser b is correct

In your own words, can you explain where a hot
spot can be found AND what does it looks like?

Answers

Answer:

well for one you can find a lot for examples like if the light of a blazing hot sun was reflecting on a wooden stick the spot where the sun is reflecting would have a red mark with smoke comming out the stop

what are the four primary uses or benefits of the nguni breed amongst South African communities?​

Answers

Answer:

Utility: The Nguni cattle are used for milk and meat; their socio-cultural functions are also important. The body conformation of the Nguni is more of a dairy than beef type but it is principally used for beef production and for work.

Explanation:

this part too #stresscrying

Answers

Explanation:

It could be that both the parents were heterozygous, meaning having a dominant and recessive allele for example Aa..after these are paired you would see that they will form a white fur offspring.

Those who argue that objectivity is impossible are known as activitists.
O True
O False
ASAP
AND THANK YOU

Answers

The answer is true hope this helps

Pls help this is due today

Answers

Answer:

scientific method can help resolve problems logically

Answer:

b. scientific

Explanation:

the method most talked about in science is the scientific method. I've never really heard of any of the other methods, they don't make sense with the question anyway.

hope this helps! lemme know if you need more

¿A que evidencia de la evolucion hacen referencia los arboles evolutivos? A.Embriologia B.Regristro fosil C.Distribucion geografica D.Grupos taxonomicos E.Anatomia comparada

Answers

Answer:

D.Grupos taxonomicos

Explanation:

Un árbol evolutivo muestra la relación entre los organismos biológicos a medida que evolucionan a partir de un ancestro común.

Los árboles evolutivos indican que las especies a menudo comparten un ancestro común.

El árbol evolutivo muestra la relación entre los grupos taxonómicos a medida que avanza el proceso de evolución.

sources of potassium for plants​

Answers

Answer:

mined rock powders and wood ash.

Explanation:

Homologous structures, or shared detailed structures, shows us that we are _____.
A. unrelated organisms

B. bacteria

C. aliens

D. related

Answers

Answer:

Hi, there the answer is D. related

Explanation:

Homologous structures are similar structures in related organisms.

Hope This Helps :)

Answer:

it is d i think

Explanation:

Other Questions
Consider sebaceous and ceruminous glands. Then, click and drag each label into the appropriate category based on whether it pertains to sebaceous glands, ceruminous glands, or both.A. Coats guard hairs to improve their informanceB. Usually opens up into a hair follicle C. Simple, coiled, tubular glands D. Secretes earwax E. Coats the scalp hair with oil F. Blockage and infection can cause pimples 1. Sebaceous 2. Ceruminous Nigel has 2 dogs one eats 21/2 pounds of food each week. The other eats 1 3/8 pounds a week together how much food do the dogs eat in a week? The temperature in Alaska was -12 degrees Fahrenheit.It then dropped 5 degrees overnight.what is the new temperature. can someone unscramble these words and put them in a sentence? thanks In how many ways can the letters in the word 'Oklahoma' be arranged? Need honest and urgent help thank you A substance with two oxygen atoms is combined with a substance with one oxygen atom to form one product. What is true of the product? Using the chart of word affixes, which is the most likely meaning of the word epidermis what does "the peom is structured around an implied contrast" mean Peterkin Inc needs to arrange financing for its expansion program. Sandy Bank offers to lend Peterkin the required funds on a loan in which interest must be paid monthly, and the quoted rate is 6 percent. Money Plus Bank will charge 6.8 percent, with interest due at the end of the year. Which bank should Peterkin take the loan from Could this couch be considered 3D art? A/yes, any physical object is artB/ no, it does not count as a sculpture C/yes, it meets the standards for 3-D artD/no, you can sit on it, so it is furniture PLEASE HELP!!! WILL GIVE 50 POINTS AND BRAINLIEST!!!! General de Gaulle in his speech "The Appeal of June 18" appealed to whom? A. to all French people in France B. to French soldiers, engineers and workers on British soil C. to the French army in France D. to resistance fighters in France Which of the following is not a product of glycolysis?ATPglucosepyruvic acidNADH if f(x) = 3x+2 what is f(5)? Atanu, an American Indian, feels harassed by tourists who visit his village. He does not like that these tourists sometimes barge into his hogan without permission to photograph his family. When tourists attempt to talk to him, he pretends to not to speak English. He is planning to lead an organized protest to stop the harassment of locals by tourists. In this scenario, Atanu's attitude toward tourists visiting his village exemplifies _____. resistance revitalization and adoption boundary maintenance retreatism Which choice is equivalent to 4 square root 3?A. 12B. 748C. V12D. 6 5. In A ABC, mZ A = 100%, m B = 30, and m2 C = 50. Which lists the sides from largest tosmallest? How to write effective essay that compares news reports and editorials Enzymes are proteins that speed up chemical reactions in the body.How do they work?A) They provide a path with lower activation energy.B) They increase the concentration of reactants.C) They decrease the concentration of products.D) They increase the surface area of reactants. Answer this for me thanks