Law

_____ holds that the Supreme Court should overturn the elected branches of government reluctantly and as a last resort.A) Judicial reproachB) Judicial restraintC) Judicial activismD) Stare decisis
1 Answer
What are the methods of judicial activism?
1 Answer
Local legislation was passed to protect animal species prone to extinction. the legislation included criminalizing poaching, setting limits on number of fish people can catch, and protecting habitats. which of the following threats shown in the graph will most likely decrease the most as a result of the legislation?
1 Answer
Who uses the PACS system?
1 Answer
A law may be unjust and contrary to some principles of Government but parliament is not controlled in its discretion and where it err, its error can only be corrected by itself Erskine may. Discuss
1 Answer
Who can create PACs?
1 Answer
What is canvassing in selling?
1 Answer
What are 3 purpose of taxation?
1 Answer
Do US appellate courts have original jurisdiction?
1 Answer
What branch of government controls the National Guard?
1 Answer
What happened in Vietnam after World War II ended?
1 Answer
the citizens of ________ are most likely to participate as campaign volunteers during an election.
1 Answer
What did Roosevelt believe was the purpose of government?
2 Answers
In a violent culture, the level of background violence is _____.Group of answer choices
1 Answer
examination of bill of entry is done to vouch
2 Answers
Candidates for the U.S. House of Representatives must be at least 25 years old, and candidates for the U.S. Senate must be at least how old? Select one: O A. 25 O B. 21 . 30 O D.35
2 Answers
How many repeats are there for this STR? Refer to the following DNA sequence to answer the questions: CTAGAAGCTTAAAGCTTCATCATCATCATCATCATCATTTAAGCTTCAAAGCTT
1 Answer
50.Which is a responsibility of state government?A. providing fire protectionB. regulating public educationC. providing clean drinking waterD.regulating public transportation
1 Answer
Which of the following best describes who must accompany the learner for legal use of a Learners license?
1 Answer
What are some of Lloyd Austins immediate goals?
1 Answer
Hey, this isn't homework but I don't know where else to find an answer and my family really needs help. My sister in 12 and has been "Baker acted" she was supposed to get out today, but they moved her release date to this upcoming Tuesday. My parents never signed anything, we can't see her or visit her. We didn't put her in there. The police took her there. Can we get her out of there?
1 Answer
Which of the following articles of the U.S. Constitution created the Executive Branch?A) Article IVB) Article IIC) Article IIID) Article I
2 Answers
who's task is it to develop natural resources and protect our historical heritage?
2 Answers
Nicki Minaj (50% full power) vs Scarlet Witch who wins
2 Answers