1. Why do you think Malala is considered to be a courageous person ?
2. How was Malala prevented from receiving an education ?
3. Explain how her actions after the attack are an example of moral courage ?

Answers

Answer 1

Explanation:

Q1) Malala has shown more courage in facing down the Taliban than Pakistan's government and its military leaders. Her father, who once led a school for girls and has shown uncommon bravery in supporting his daughter's aspirations, said she had long defied Taliban threats.

2)Yousafzai began speaking out for girls' education at the age of 11 in her native Pakistan. After surviving an assassination attempt by the Taliban in 2012, she co-founded the Malala Fund with her father Ziauddin to champion every girl's right to 12 years of free, safe, quality education.

2)


Related Questions

HELP ASAP
Describe the government's role in creating the
foundation for a market economy.

Answers

Answer:

Economists, however, identify six major functions of governments in market economies. Governments provide the legal and social framework, maintain competition, provide public goods and services, redistribute income, correct for externalities, and stabilize the economy.

The government creates and maintains a market economy by: establishing law and order. ... setting market standards. providing public goods

Explanation:

Governments frequently fund the military, address environmental issues, define and safeguard property rights, and work to increase competition in the market.

What do you mean by the market economy?

In a market economy, the majority of the resources are owned by people rather than the government.

This pertains to labour, capital, and land. In a market economy, people regulate the use and cost of these resources through freely chosen actions in the market.

When the advantages of a government programme outweigh the disadvantages, there is an economic function for government to perform in a market economy.

Governments maintain competition, offer public goods and services, redistribute income, account for externalities, and stabilize the economy in addition to providing the legal and social framework.

Therefore, the Governments frequently fund the military, address environmental issues, define and safeguard property rights, and work to increase competition in the market.

To know more about the market economy, visit:

https://brainly.com/question/2343400

#SPJ2

Which of these reform movements was based mostly on health concerns?
A. City planning
B. Education
C. Making the city more beautiful
D. Sanitation

Answers

Answer:

D. Sanitation

Explanation:

Sanitizing things can get rid of dangerous bacteria, and it can decrease the likelihood of people getting sick.

None of the other answers deal with health. City planning was meant to increase the amount of housing available, Education was introduced to make the population more educated and informed, and they made cities more beautiful to encourage people to move to the city.

I hope this helps :)

Answer:

D.  sanitation

Explanation:

Sanitizing things can get rid of dangerous bacteria, and it can decrease the likelihood of people getting sick.

None of the other answers deal with health. City planning was meant to increase the amount of housing available, Education was introduced to make the population more educated and informed, and they made cities more beautiful to encourage people to move to the city.

please let me know if I'm wrong

Question 7 of 10 How did Hiram Rhodes Revels feel about former Confederates? O A. He wanted to ban them from politics. B. He wanted them to respect the rights of African Americans O C. He wanted them to give their land to freed slaves. O D. He wanted to punish them harshly.​

Answers

Hiram Rhodes Revels feel about former Confederates as he wanted them to respect the rights of African Americans. Thus, option B is correct.

What is colony?

Colony is defined as a group of individuals who has been leave their motherland or place of their birth to start farming in a new place or land which is connected along with their own nation.

The Georgia colony was the colonies belong to British America and it belongs to southern part of British America. The Georgia American colony was thirteen original colonies of America.

Therefore, Hiram Rhodes Revels feel about former Confederates as he wanted them to respect the rights of African Americans. Thus, option B is correct.

Learn more about colony here:

brainly.com/question/385363

#SPJ1

Answer:

B. He wanted them to respect the rights of African Americans

Explanation:

❗️❗️HELPPP❗️❗️WILL MARK BRAINLYIST
Which group became known as vassals?
Samurai
Shogun
Merchant
Daimyo

Answers

Daimyooo is the correct answer
I would say Samurais were vassals towards the Daimyos (lords). Merchants were lower class, similar to peasants and the Shogun was the top Daimyo of the country and the clan ruled over Japan.

Answer: Samurais were vassals towards their Daimyos.

Overall minority enrollment increased 50.7% during these years. How might the increase in the number of minority students who attended college affected our society?

Answers

Answer:

It allowed more young people to have access to higher education and to seek better paid jobs, which reduced poverty and promoted many professionals to society.

Explanation:

With the increase in the number of students, who fit into social minorities, enrolled in higher education, society has seen itself within a major change. This is because this increase allowed young people, previously discriminated by society, to have access to quality education that would transform them into professionals able to enter the job market and generate benefits for society. In addition, higher education has enabled these young people to access quality jobs that prevent them from engaging in illegal activities and promote improvements in the quality of life.

Which would not describe Rebecca Latimer Felton? She was the first woman Senator in the U.S. She was against the prison labor system. She was against women's political rights. She led the right of women to keep their earnings

Answers

Answer:

She was against women's political rights

Explanation:

She is often remembered for her work in Georgia’s women’s suffrage movement.

6x - 8y - 5x + 3y
HELLLLPPP

Answers

Answer:

x - 5y

have a nice day

good luck

X -5y :) wrong subject btw

Afro Circus, Afro Circus, Afro

Polka dot, polka dot, polka dot

Move it!

Woman, you're nice and energetic

(Circus Afro, Circus Afro)

Woman, ya nice broad face

And ya nice hip

(Polka dot, polka dot, polka dot, Afro)

Woman, you're nice and energetic

Big ship 'pon de ocean that a big Titanic

Woman, ya nice broad face

And ya nice hip

Make man flip and bust them lip

Woman, you're nice and energetic

Big ship 'pon de ocean that a big Titanic

Whoa

I like to move it move it

I like to move it move it

I like to move it move it

Yes!

Ra da da da da da da da Circus

Da da da da da da da da

Afro Circus, Afro Circus, Afro

Polka dot, polka dot, polka dot

(Move it!)

Da da da da da da da da Circus Circus Circus Circus Circus (move it!)

Da da da da da da da da Afro Afro Afro Afro Afro

Woman, ya cute

And you don't need no make up

Original cute body you a mek man mud up

Woman, ya cute

You don't need no make up

Original cute body you a mek man mud up

Come on

Physically fit

Physically fit

Physically

Phyiscally

Physically fit!

Come on

Physically fit

Physically fit

Physically

Phyiscally

Physically fit!

I like to move it move it

(Come on)

I like to move it move it

(Come on)

I like to move it move it

(Come on)

You like to (move it!)

I like to move it move it

I like to move it move it

I like to move it move it

You like to (move it!)

Woman, ya nice, sweet fantastic

Big ship 'pon de ocean that a big Titanic

Woman, ya nice, sweet fantastic

Big ship 'pon de ocean that a big Titanic

I like to move it move it

He like to move it move it

She like to move it move it

You like to (move it! Move it! Move it!)

I like to move it move it

I like to move it move it

I like to move it move it

You like to (move it! Move it! Move it!)

I like to move it move it

He like to move it move it

She like to move it move it

You like to (move it!)

Three, two, one

Answers

Answer:

Ummm, sorry is this lyrics to one of the Madagascar music's?

Explanation:

Well, at least we will know the lyrics to it, LOL.

Can someone explain the meaning of this drawing

Answers

Answer: i can see a happy man trying to cut down a tree

Explanation: he thinks cutting down trees is funny

think of another civilization to add to this list.

The Mayans, Feudal Japan, Vikings, Native Americans, Midieval times, romans, Greeks, Mongols, plagued France, colonial Mexico, colonial England/America, cavemen, pirates, old west, ancient Egypt

Answers

Answer:

Israel, Hawaii before they were a U.S. state, Prussia

Explanation:

HELP! FAST! PLZ!!! I'll GIVE BRAINLY!!!
How was the advent of the trolley most beneficial to workers?

Trolleys were a cheap form of transportation.
Workers could get to work more quickly.
Workers could live farther away from work.
Trolleys were a convenient way to travel.

Answers

Answer:

Its C

Explanation:

Got 100%

Workers could live farther away from work: was the advent of the trolley most beneficial to workers. Thus, option C is the correct option.

What are the benefits of trolleys?

For many assembly, manufacturing, and warehousing operations, trolleys are an economical piece of equipment since they can be utilized to convey a range of goods and materials. Because trolleys make it easier for workers to carry things about the warehouse, they improve safety and productivity. Due to this, picking and warehouse trolleys are frequently among the items of equipment that are utilized the most in a warehouse setting.

One person may transport bigger products or items in quantity by using heavy-duty trolleys, which reduces the need for extra help with manual carrying or pricey and dangerous forklift trucks. Employers should always provide tools to help workers complete their tasks safely and without the danger of strain.

Learn more about trolley here:

https://brainly.com/question/30917316

#SPJ7

Harappan civilization

Answers

Harappan civilization, the earliest known urban culture of the Indian subcontinent. The nuclear dates of the civilization appear to be about 2500–1700 bce, though the southern sites may have lasted later into the 2nd millennium bce.

what is the house of burgesses

Answers

Answer: The first legislative body in English America.

Explanation: Hope this helps :)

Answer:

Virginia's political system which was comprised of a governor, a council of a few privileged planters, and a house of representatives elected by all landowners

Explanation:

how are montesquieu's ideas still in use today?​

Answers

Liberty

Liberty consists principally in not being forced…Countries are well cultivated, not as they are fertile, but as they are free…when there is no abuse of power…In a country of liberty, every man who is supposed a free agent ought to be his own governor…The liberty of one citizen is of greater importance to the public than the ease or prosperity of another…The real wants of the people ought never to give way to the imaginary wants of the state.

Property

When the inhabitants of a state are all free subjects…each man enjoys his property with as much right as the prince…The public good consists in every one’s having his property…invariably preserved… Each citizen contributes to the revenues of the State a portion of his property in order that his tenure of the rest may be secure…Whenever the public good happens to be the matter in question, it is not for the advantage of the public to deprive an individual of his property, or even to retrench the least part of it by a law, or a political regulation.

Trade

Trade produces…exact justice, opposite to robbery…[it] renders every man willing to live on his own property…When a democracy is founded on commerce, private people may acquire vast riches without corruption of morals…It is much better to leave trade open than…to restrain the liberty of commerce…[it] flies from the places where it is oppressed, and stays where it has liberty to breathe.

Government

In an extensive republic…there are trusts too considerable to be placed in any single subject; he has interests of his own; he soon begins to think that he may be happy and glorious, by oppressing his fellow-citizens…But we cannot give someone else greater power over us than we have ourselves…There is no crueler tyranny than that which is perpetuated under the shield of law and in the name of justice… Experience shows us that every man invested with power is apt to abuse it, and to carry his authority as far as it will go…To prevent this abuse, it is necessary from the very nature of things that power should be a check to power.

Answer:

Effects on the Modern World: Montesquieu's writing and ideologies in his book The Spirit of the Laws had a major impact on modern society, helping create the bases for the democratic institutions after the French revolution, and can even be seen in the constitution of the United States of America.Explanation:

________ people left behind giant earthen mounds in many different shapes.


 
1.Mayans

 
2.Iroquois

 

3.Hopewell

 
4.Inuits​

Answers

Answer:

C)

Explanation:

Hopewell

help me is this ble​

Answers

Answer:

k

Explanation:

Why was Germany able to defeat France so quickly in World War II

Answers

Answer:

Because  German army developed the Blitzkrieg tactics.

I hope this helps

Enjoy the rest of this day

During WWII, Germany was able to defeat France by using the Blitzkrieg tactics on them.

What was WWII?

WWII was the second most warfare happened between the powerful countries of that time starting from the year 1939 with its ending in 1945.

The blitzkrieg tactics were used by the military troops of Germany which was concerned with hitting the weaker sections of France by initiating mobile attacks on them. This led to devastation and destruction of France in highly manner.

Therefore, the use of blitzkrieg tactics helped the Germany in defeating France very easily and in quick manner.

Learn more about WWII in the related link:

https://brainly.com/question/27112836

#SPJ2

-I WILL GIVE BRAINLIEST-

Nations and peoples without an official state government are called

A. sovereign states

B. independent states

C. stateless nations

D. territories

Answers

Answer: C

Explanation: a stateless nation is an ethnic group or nation that does not possess its own State and is not the majority population in any state

I believe b but could be wrong just going of my head

Select the italicized word that is not capitalized correctly.

You travel one hundred miles South and you will be at the Mexican border.

A.
You
B.
South
C.
Mexican
D.
border

Answers

I think the answer is D??

Answer:

D

Explanation:

The 22nd Amendment limited the president for serving more than 2 terms in office. How did this decision made by the Constitution affect the U.S. Future?

Answers

Answer:

This allowed the US to possess political diversity and lessened the incidence of abuse of power.

Explanation:

This promoted democracy, preventing the United States from being forever in the hands of a single president, who would have a strong concentration of power. It also allowed for political diversity in the country, as citizens are allowed to choose presidents with different proposals.

Furthermore, this amendment prevented the United States from suffering from abuse of presidential power in the future, since a president's government is finite and controlled.

im not smart help me :)
What role did de Boré play in the Louisiana colony?
A. He was the first governor of Louisiana.
B. He was the first mayor of New Orleans.
C. He created new rights for enslaved workers.
D. He led the largest slave revolt in US history.

Answers

Answer:

The answer is B he was the first mayor of New Orleans

Explanation:

James Wilkinson was the first governor of Louisiana.

And I don't think he was involved with the other two answers.

6. This church, which was built during the reign of Justinian, stands as one of the greatest examples of Byzantine architecture: a. St. Peter's Basilica, Rome b. Basilica of San Vitale, Ravenna c. Hagia Sophia, Istanbul d. St. Vitus Cathedral, Prague

Answers

Answer:

c. Hagia Sophia, Istanbul.

Explanation:

The Hagia Sophia Grand Mosque in Istanbul, Turkey was built in 537 during the imperial rule of Constantinople, now known as Istanbul. This architectural structure was the largest Christian Church during the early Roman empire.

This monument was built during the reign of the Byzantine emperor Justinian I. It stands as one of the greatest examples of Byzantine architecture.

Thus, the correct answer is option c.

Which answer best summarizes how the Declaration of Independence was written? (1 point)

Group of answer choices

Five members of Congress discussed and wrote the draft together, and Thomas Jefferson edited it.

Thomas Jefferson wrote the first half of the draft, and Benjamin Franklin and John Adams wrote the second half.

Thomas Jefferson and John Adams wrote the document, and five members of a committee from Congress approved it.

Congress appointed a committee, Thomas Jefferson wrote the draft, and John Adams and Benjamin Franklin made edits.

Answers

I would say the answer is Congress appointed a committee, Thomas Jefferson wrote the draft, and John Adams and Benjamin Franklin made edits.

Explanation:

- hope that helped :)

How were the Pilgrims’ goals for religious freedom hampered during the early years of the Plymouth colony, and how did they overcome the obstacles?
ASAP

Answers

Answer:

The pilgrims at the Plymouth colony, located today in the state of Massachusetts, struggled to survive because of their lack of capability to produce food for themselves. The Native Americans taught the pilgrims how to survive off of the land by growing crops and hunting wild game.

Even though China has a communist form of government, what is China called?
A.)unitary
B.)democracy
C.)republic
D.)oligarchy

Answers

Explanation:

Political party of the People's Republic of China

Which Latin American country was the first to be founded by former slaves?
a. South America
b. Venezuela
c. Mexico
d. Haiti

Answers

Answer:

c

because im am very smart and i know things

Is the speaker more concerned about the native people, or the white men? How do you know?

Answers

Answer:

White men

Explanation:

The speaker was more concerned about the white men because he thought that the purpose and the so-called burden of the white men is to conquer and educate the undeveloped people and help them build a civilization. A very racist concept that on the surface looks like it aims to help the natives but actually in the end it never happened that way.

5 ways the us responded to fidel castro

Answers

Answer:

1) The U.S. imposed trade restrictions/trade embargo

2) Planned an invasion, the Bay of Pigs, which was ultimately a disaster and loss for the U.S.

3) The U.S. attempted to assassinate Castro 8 times.

4) President Kennedy prevented any business to be conducted with Cuba.

5) I'm not sure if this counts, but the US responded in great fear to not only Castro's rise to power as a communist leader, but also the fact that the Cuban Missile Crisis was enough of a scare.

6) for extra, the US ended diplomatic relations with Cuba.

I need to know what thing goes in where

Answers

Answer:

I have NO clue what you are talking about

Explanation:

appoint military commander in chief congress or state

Answers

Answer:

Article II Section 2 of the U.S. Constitution, the Commander in Chief clause, states that "[t]he President shall be Commander in Chief of the Army and Navy of the United States, and of the Militia of the several States, when called into the actual Service of the United States."

Explanation:

Padlet: BellaSnow15

Other Questions
This is the last giveaway for today!! if you could be any movie character who would you be? GIVING BRAINLIEST FOR WHO ANSWERS FIRST! Please help me answer 16 please What month did the October Revolution occur? what were the political limitations of african american during 1865-1900? one paragraph the sunshine Club collected 524 cans for a canned food drive. the cans were then split up equally into 8 boxes. Part A how many can were in each box? Part B how many can were left over after the boxes were filled? Helppp plzz!! A.) Side - Side - SideB.) Side - Angle - SideC.) Angle - Side - AngleD.) Angle - Angle - SideE.) Hypotenuse - LegF.) Not enough information. my picture please hahahahahahah Read the excerpt from The Dark Game: True Spy Stories from Invisible Ink to CIA Moles.Tension between the two sides escalated until June 1948, when the Soviets blocked all western access to the capital. In this first real crisis of the Cold War, the West was not going to be denied by the Soviets.If the underlined word were replaced with the word "event, the tone of the excerpt would bemore resentful.more intellectual.less intense.less objective. how might have the oppressive British rule influenced the ideas of the articles of confederation ? A collection of the same kind of cells working together to do the same job HELP PLEASE ASAP Read the excerpt from "On Becoming an Inventor" by Dean Kamen.When I was twelve years old and Barton, my older brother, was around fifteen, we took over the family basement. At first, I made a darkroom for developing pictures, and Bart was using it as his lab where he was raising about one hundred white rats, removing their thymus glands, and trying to figure out the glands' dysfunction. He wanted pictures taken of his experiment, doing the surgery on rats, and since I already had a darkroom, I took the pictures, though somewhat reluctantly. I didn't like the blood.What can you conclude about Barton from the excerpt?He was interested in solving medical mysteries at a rather early age.He did not understand why Dean would be squeamish about the blood.He went on to become a very famous and successful doctor.He had a severe dislike for rats and all other kinds of rodents. find the slope of the line passing through the points (-5,5) and (-5,-8) What is the unit rate of 232 people in 8 classrooms? i need help with this pleasee five men build a wall in 10 days how long will it take 10 men Anchara drops a penny from a height of 60 feet above the ground. The equation h=-16t^2 + 60 models the penbys height h i feet as a function of time t in seconds whatvare the solutions P3- is a(n) ______________________, so it ________________ valence electrons. Group of answ er choices anion, gained cation, gained cation, lost anion, lost The following DNA is being replicated and the origin of replication is in the middle of the sequence and marked with three stars ***. 5'ATCGGGCTACCCATGAAATGCTAGCATT***TAAGATCTTAAGCTAGCTAGTTCGATCTGA3'What is the sequence of the primer for the LEADING strand? Your answer should be 8 nucleotides long, written from 5' to 3' and only include the nucleic acid sequence (ex: ACTACTAC).note: there are two answers for this question A farmer's market is selling peaches for $2.00 a pound. If you buy 2 pounds, you save 10% on each pound. How much does it cost to get 2 pounds of peaches?