The following DNA is being replicated and the origin of replication is in the middle of the sequence and marked with three stars ***.

5'ATCGGGCTACCCATGAAATGCTAGCATT***TAAGATCTTAAGCTAGCTAGTTCGATCTGA3'

What is the sequence of the primer for the LEADING strand? Your answer should be 8 nucleotides long, written from 5' to 3' and only include the nucleic acid sequence (ex: ACTACTAC).

note: there are two answers for this question

Answers

Answer 1

Answer:

5'GATCGTAA3'

5'ATTCTAGA3'

Explanation:

As requested in the question above, the primers were presented with 8 nucleotides, with the nitrogenous bases of the DNA, and in the 5'-3 'direction.

Primers are small fragments of DNA that are used by DNA polymerase to form new strands. The primes attach to pieces on the ribbon, through the complementarity of the nitrogenous bases, serving as a template for the DNA polymerase to create the new ribbon.

DNA polymerase uses primers at the origin of replication, and can follow the path from the right or from the left, depending on the primers used, for this reason, this question has two answers.


Related Questions

In crime scene, as investigator you saw an alleged almost dried semen in the bedsheets at the crime scene. How will you collect the specimen?​

Answers

Answer:

an investigator will often use a black light to scan an area for traces of bodily fluids left at the crime scene. if there’s a substance that resembles semen or blood, they will often times apply a spray if it is dry and use a cotton swab to collect it in a vial to test back at the lab for dna evidence.

Explanation:

What is DNA and what is it for

Answers

DNA stands for Deoxyribonucleic Acid. DNA holds genetic information that determines and organisms traits. DNA contains the instructions for making proteins.

The only step in cellular respiration that produces no energy (ATP) is:

Answers

Answer:

Cellular respiration is a metabolic pathway that breaks down glucose and produces ATP. The stages of cellular respiration include glycolysis, pyruvate oxidation, the citric acid or Krebs cycle, and oxidative phosphorylation.

Explanation:

why should we care our sense organ​

Answers

Answer:

Our sense organs are very important for us as they allow us to connect with the world. Our five sense organs a

How many protons and electrons does Neon have???

Answers

neon has 10 protons and 10 electrons!

3. Which of the following is not true of meiosis?
A. O involves DNA replication
B. O provides genetic variation
C. O occurs in reproductive cells
D. O prevents genetic variation

Answers

Answer:

D prevents genetic variation

D. Prevents genetic variation.

All the others sum up to each other if ya think about it. Hope this helps!

Place the following statements in the correct order as they occur in DNA replication. (5A)
1. Appropriate free nucleotides are added to the complementary DNA
strands.
2. DNA unwinds.
3. DNA coils up.
4. The hydrogen bonds are broken between the nitrogenous bases.

Answers

Answer: The answer is C.

Explanation: I jus got done taking the test. Also remember the first start is breakin through and tearing apart the hydrogen base bonds, then they’re glued so they do not coil back up.

The correct order of replication are DNA unwinds then the The hydrogen bonds are broken between the nitrogenous bases, and Appropriate free nucleotides are added to the complementary DNA strands. DNA coils up.

What is DNA replication?

DNA replication is the process through which cells make copies of the genome's DNA. A cell must first copy (or duplicate) its entire genome before it can divide, ensuring that each daughter cell has a complete genome upon division.

One of DNA's most astounding tricks is likely DNA replication. If you stop to think about it, every cell has all the DNA required to create every other cell.

Therefore, DNA is a molecule that can be copied to create almost exact duplicates of itself. Considering that there are almost three billion base pairs in DNA that need to be copied, this is even more astounding. DNA polymerases, which are molecules dedicated solely to copying DNA, are also used in replication.

Therefore, The correct order of replication are DNA unwinds then the The hydrogen bonds are broken between the nitrogenous bases, and Appropriate free nucleotides are added to the complementary DNA strands. DNA coils up.

To learn more about DNA, refer to the link:

https://brainly.com/question/264225

#SPJ2

Why is a fern a vascular plant

Answers

Answer:

Ferns are seedless, vascular plants. They contain two types of vascular tissue that are needed to move substances throughout the plant. Evolutionarily, this addition of vascular tissue to plants is what allowed ferns to grow up and out rather than just spreading along the ground.

Explanation:

Could you please mark me as the brainliest answer

Can I pls get help !!

Answers

Answer:

I am not certain but I think it's DNA to RNA to protein may be wrong but I think that's the answer

Answer:

C. DNA to RNA to protein

Explanation:

This question is asking about protein synthesis. Let’s analyze the process.

It begins in the nucleus. DNA is too large to pass through the nucleus, so something has to be done. DNA is “unzipped” using an enzyme called polymerase. Nucleotides attach to create a new strand of messenger RNA, in the process of transcription. The mRNA is small enough to pass through the nucleus.

So the first step is DNA to RNA.

Then, the mRNA makes it way to the ribosome. Here, translation takes place. Transfer RNA reads the mRNA and matches a set of three bases (codon) to an anticodon. The tRNA attaches amino acids based on the codon. A protein will form and bend into a specific shape.

So, the next step is RNA to protein.

Overall, the process is DNA to RNA to protein. Choice C is correct.

Why could organisms that use a K-selected life strategy be more at risk when environmental conditions change?

Answers

Answer:

K-selection organisms have the maximum chance of surviving in the surrounding where the number of organisms is near the carrying capacity, however, the lack of offspring makes them endangered species.

Explanation:

K-species can give the offspring with the great possibility of surviving until mature.

K-selection is the most frequent in big animals, that have a long life span, and many generations that meet. K-selection organisms give less offspring but with a stronger organism.

However, these organisms are more endangered, as they tend to have fewer offspring, so their populations cannot recover as quickly from disorders such as excessive hunting or fire.

Scientists reported that a fungal pathogen, may negatively a!ect the growth of soybeans (Glycine max). Soybean growth decreased during three years of high rainfall, and the soybean roots were poorly developed. Close relatives of R. anaerobis are plant pathogens and grow in the soil. A lectin-like protein was found in the soil around the soybean roots. is protein may have been secreted by the fungus. Lectins induce mitosis in some root apical meristem tissues. In many instances, rapid cell divisions weaken plant tissues.You have been asked to investigate whether the fungal pathogen lectin a!ects the number of cells undergoing mitosis in a di!erent plant, using root tips.• What is your experimental hypothesis? Your null hypothesis? Are these the same?• How would you design an experiment with onion bulbs to test whether lectinsincrease the number of cells in mitosis?• What would you measure, and how would you measure it?• What would be an appropriate control for your experiment?Your teacher will provide you with untreated and lectin-exposed roots. You should be comfortable identifying cells in mitosis or in interphase before you begin examining the chromosome squashes.

Answers

Answer:

What is your experimental hypothesis?

Experimental hypothesis: If we introduce lectins into the root systems of plants, then they will cause rapid cell division, mitosis, to begin in the root apical meristem tissues which will weaken plant tissues.

Your null hypothesis?

Null hypothesis: If we introduce lectins into the root systems of plants, then there will be no initiation of mitosis in the root apical meristem tissues and the plants will not weaken as a result.

Are these the same?

These are not the same, the experimental hypothesis states that lectin will have an effect on the rate of cell division within the plants which will cause the plant to be weaker, however, the null hypothesis states that lectin will have no effect on the rate of cell division and therefore will not affect the plants overall strength. The null hypothesis is the opposite of the experimental and we are testing the experimental hypothesis to decide whether to accept or reject the null hypothesis.

How would you design an experiment with onion bulbs to test whether lectins increase the number of cells in mitosis?

Assuming these onion bulbs have roots, we would get multiple untreated onions and isolate them by putting them into a controlled environment within a lab by using soil obtained from a store, steady LED light from the room, watered 2 times a day with 2 cups (480 ml) each time and finally isolated the same lab room. The only testable variable in this experiment will be whether the onions are given the lectin or not. In one group we would have the control group, the water they are given would be purely distilled water, however, in another group we would have the experimental group, which would be treated with water mixed with lectin. We are looking to study if there is a change, more specifically an increase, in the cell division of the onion within the treatment/experimental group.

What would you measure, and how would you measure it?

We would need to observe pictures taken of the onion cells under a microscope in order to count the cells in each phase of mitosis. If more cells are visibly undergoing mitosis, and more are present in the picture (density), then we can know that the lectin is causing an increase in rapid cell division. We will compare the amount of cells in each phase with that of the onion which was used as a control.

What would be an appropriate control for your experiment?

An untreated onion that is given distilled water as a treatment, a placebo, which allows us to compare no treatment to the effects of the treatment in the experimental group.

Explanation: I hope the answers are very thorough :) you're welcome future AP Bio students.

If the experiment goes fine, the roots of Group-1 will more denser than the control group.

Experimental hypothesis:

If we introduce lectins into the root systems of plants, then it will increase , mitosis, which will weaken the plant tissues.

Null hypothesis:

If lectins is introduced into the root of plants, then there is no initiation of mitosis in the root apical meristem and the plants will not weaken.

Experimental hypothesis and Null hypothesis are not the same because both statements are opposite.

The onion bulbs with roots, will be divided into 2 groups

1. Onion bulb's liquid media with lectin.

2.Onion bulb's in water only.

The onion bulbs with water apparatus will use as control. The density of the cell will be measured under the microscope.

Therefore, if the experiment goes fine, the roots of Group-1 will more denser than the control group.

To know more about Null hypothesis,

https://brainly.com/question/4454077

What jobs do cells have?

Answers

Answer: Cells are the basic building blocks of all living things. The human body is composed of trillions of cells. They provide structure for the body, take in nutrients from food, convert those nutrients into energy, and carry out specialized functions.

Explanation:

BEST/FIRST ANSWER GETS BRAINLYEST!!!! PLEASE HELP

Which evidence shows that landmasses had different climates millions of years ago and supports the theory of
continental drift?

Ⓐ coal fields in several continents

Ⓑvolcano formation

Ⓒtropical plant fossils on

ⒹArctic islands
folded mountains in Africa and South America

Answers

The answer would be C.

"The gross primary productivity of a meadow in southeastern Kansas is found to be 38,000 kcal/m 2 . Respiration which is measured by the amount of CO 2 released is 13,500 kcal/m 2 , what is the net primary productivity for this ecosystem, in kcal/m 2 per year

Answers

Answer:

Net primary productivity = 24,500 kcal/m²

Explanation:

Given:

Gross primary productivity = 38,000 kcal/m²

Respiration amount = 13,500 kcal/m²

Find:

Net primary productivity

Computation:

Net primary productivity = Gross primary productivity - Respiration amount

Net primary productivity = 38,000 - 13,500

Net primary productivity = 24,500 kcal/m²

What would be the best diet to your knowledge?

Answers

I think limiting portion sizes as well as eating foods lower in calories. You should drink water and limit your consumption of foods that do not have nutritional value.

What are these species BowHead and Omura a type of​

Answers

Answer:

The bowhead whale (Balaena mysticetus) belongs to the Balaenidae family and is the only living representative of the Balaena genus. The Omura whale (Balaenoptera omurai) had been defined as a new species in 2003 and quickly thereafter as an ancient basal lineage to a clade of Bryde / ein whale.

Which of the following structures would NOT be found in a prokaryotic cell?
DNA
cell membrane
ribosomes
nucleus

Answers

I think its cell membrane
The answer is a nucleus, this is because all of the prokaryotes DNA is found as plasmids and genetic material floating around the cytoplasm.

What are the differences and similarity between action potential and graded potential?


Help please

Answers

Answer:

Depending on the stimulus, graded potentials can be depolarizing or hyperpolarizing. Action potentials always lead to depolarization of membrane and reversal of the membrane potential. Amplitude is proportional to the strength of the stimulus. ... Duration of graded potentials may be a few milliseconds to seconds.

Explanation:

Create an illustration showing the application of Chargaff’s rule in the structure of DNA.

Answers

Just make an example of base pairing and then put a 10 beside the A a 10 beside the t a 40 beside the c and 40 beside the G

Conjecture what would happen if a primate infant did not possess your chosen primate hand features. Answer this question with the survivability of the infant in mind

Answers

Answer:

Where the primate infant did not possess primate hand features, it will not be able to feed itself.  For example, a monkey cannot survive without its grasping hands.  It uses them to feed itself.  So if an infant monkey does not possess the primate hand features, its survival will be greatly hampered.

Explanation:

Ordinarily, primates (including humans) have five fingers on each of their hands and five toes on their feet.   Most primate species have fingernails instead of claws, and they have touch-sensitive pads on each of their digits. The hands and feet of all primates are designed for grasping, with the only exceptions being humans.  Human beings feature deep perceptions that differentiate them from other primates.

When a bee visits a flower for sweet, sweet nectar, the plant's gametes are also spread to anoher plant. What kind of symbiotic relationship is this?

Answers

Answer:

Mutualism

Explanation:

Mutualism is a type of symbiotic relationship in which the two species of organisms involved benefit from one another i.e. the actions of one benefits the other.

In this question, a bee is said to visit a flower for sweet nectar, however, in the process of feeding on the flowers nectar, the plant's gametes are also spread to another plant by the bee. This is a type of MUTUALISTIC RELATIONSHIP because the plant is beneficial to the bee by providing food (nectar) while the bee also helps the plant by helping it pollinate.

Specialized processes, or changes, that organisms have or make in order to survive in an environment are called A) adaptations B) developments C) evolutions D) growths E) maturations​

Answers

The answer is adaptation

Please help if u know the water cycle part2.

Answers

Answer:

3. Cohesion and 4. transpiration

Explanation:

Cohesion is water to water, adhesion is water to substance and surface tension is the ability of water to shrink into the minimum area it receives.

In the experiment determining the parental genotype of plant seedlings from a monohybrid cross, if the dominant color was green (C) and the recessive color was white (c), what would the parental genotype have been if plate 1 only contained white seedlings instead of all green

Answers

Answer:

cc × cc

Explanation:

This question involves a single gene coding for plant seedling. The green allele (C) is dominant over the white allele (c). This means that the green allele will mask the phenotypic expression of the white allele in a heterozygous state (Cc).

In this experiment where plate 1 only contained white seedlings instead of all green, this illustrates that all the offsprings were recessive. This is because the parental genotypes were both recessive for the color trait i.e. cc.

Note that, the recessive trait can only be expressed when the recessive alleles are present in a gene. Therefore, the parental genotype would have been cc × cc, in order to give rise to all offsprings with the recessive trait (white colour).

Describe the difference between normal vision and colorblindness. Do individuals with red/green colorblindness have difficulty seeing at night? Why or why not?

Answers

Answer:

Color vision is possible due to photoreceptors in the retina of the eye known as cones. These cones have light-sensitive pigments that enable us to recognize color. Found in the macula (the central part of the retina), each cone is sensitive to either red, green or blue light (long, medium or short wavelengths). The cones recognize these lights based on their wavelengths.  Normally, the pigments inside the cones register different colors and send that information through the optic nerve to the brain. This enables us to distinguish countless shades of color. But if the cones don't have one or more light-sensitive pigments, they will be unable to see all colors.  

Most people with color vision deficiency can see colors. The most common form of color deficiency is red-green. This does not mean that people with this deficiency cannot see these colors altogether, they simply have a harder time differentiating between them, which can depend on the darkness or lightness of the colors.

Another form of color deficiency is blue-yellow. This is a rarer and more severe form of color vision loss than just red-green deficiency because people with blue-yellow deficiency frequently have red-green blindness, too. In both cases, people with color-vision deficiency often see neutral or gray areas where color should appear.

People who are totally color deficient, a condition called achromatopsia, can only see things as black and white or in shades of gray. Color vision deficiency can range from mild to severe, depending on the cause. It affects both eyes if it is inherited and usually just one if it is caused by injury or illness.

Explanation:

Brainliest please?

Non-steroidal anti-inflammatory drugs (NSAIDS) block the actions of the COX enzymes and their production of eicosanoids from ___.

Answers

Answer:

Arachidonic acids

Explanation:

Non-steroidal anti-inflammatory drugs (NSAIDs) are drugs used due to their analgesic, anti-inflammatory effects.

It inhibit cyclooxygenase (COX) enzyme that takes part in the biosynthesis of prostaglandins (PGs) and thromboxane (TX) and the production of eicosanoids.

Eicosanoids are made by the enzymatic or non-enzymatic oxidation of arachidonic acid or from other polyunsaturated fatty acids (PUFAs) that are close to arachidonic acid which are 20 carbon units in length.

They are important cell signaling molecules that inhibit inflammation, allergy, fever,regulate abortion of pregnancy and normal childbirth, regulating cell growth.

Which of the following processes play a role in introducing both water and carbon in the earth's cycles? A) photosynthesis and respiration B) condensation and nitrogen fixation C) burning of fossil fuels and forest fires D) desertification and condensation​

Answers

Answer:

A) photosynthesis and respiration

Explanation:

The zygote of an organism has 10 pairs of homologous chromosomes. The total number of chromosomes in the germ cell of the organism is _____________. (enter numeric answer below)

Answers

Answer:
5

Explanation:
I just know that this is what it is I rememberer learning this stuff

Where is water stored?
a. clouds
b. the ground
C. animals
d. all of the above

Answers

Answer: it’s D all of the above

Explanation:

Just took the test

How are plant cells different from animal cells?
(they convert sunlight into energy, they take in material through their cell membrane, or they use energy to grow and reproduce)??

Answers

Answer:

one has a cell wall and tge other doesnt

Some of the cells are presented in both cells while other are not

Plant cells are square or rectangular in shape , and have a cell wall

Animal cells are irregular or round in shapes , does not have a cell wall .

Hope it helps:)
Other Questions
When Ryan was born, he weighed 7 pounds.At 6 months, he weighed 11.2 pounds. Amanda weighed 6 pounds when she was born, and 12.9 pounds at 6 months. Which baby had a greater percent increase in weight? Explain.PLEASE HURRY FIRST ONE TO ANSWER GETS BRAINLEIST Can two objects be at the same distance from a single point but be in different positions? Why or why not?Plsssss help meee What is the larger number: 5 or the Square Root of 26. Why? Suppose x = 0.5(300-x). What is the value of x?A.300B.150C.100D.50 what type of number is -3? A.rational. B. irrational C. whole number D. natural 3 decagrams = centgrams a car with a mass of 1200 kg travels a distance of 150 M as it moves from one stoplight to the next at its fastest the car travels at 22 m per second what is its kinetic energy at this point Is the line that passes through (8,-4) and (3,6) perpendicular To y=1/2x-4?Show your work if you can Thank you! He swiftly lost the fastidiousness which had characterized his old life. A dainty eater, he found that his mates, finishing first, robbed him of his unfinished ration. There was no defending it. While he was fighting off two or three, it was disappearing down the throats of the others. To remedy this, he ate as fast as they; and, so greatly did hunger compel him, he was not above taking what did not belong to him. He watched and learned. When he saw Pike, one of the new dogs, a clever malingerer and thief, slyly steal a slice of bacon when Perrault's back was turned, he duplicated the performance the following day, getting away with the whole chunk. A great uproar was raised, but he was unsuspected; while Dub, an awkward blunderer who was always getting caught, was punished for Buck's misdeed.This first theft marked Buck as fit to survive in the hostile Northland environment. It marked his adaptability, his capacity to adjust himself to changing conditions, the lack of which would have meant swift and terrible death. The Call of the Wild,Jack London What is the most important change that Buck goes through in this passage?A. He learns to eat more quickly B. He learns to blame other dogsC. He learns survival skillsWhy does Buck change in this way?A. He sees Pike steal foodB. He is desperately hungry C. Dub is blamed for his theft which model represents a fraction greater than 3/5? 3. In an endurance mesocycle of a beginner's program, which rep and set scheme would be most appropriate? 12-15 reps, 3 sets 4-6 reps, 1 set 8-10 reps, 4 sets 2-5 reps, 5 sets State two adaptations of the cell membrane What is the name of the group that contains potassium?O Noble GasesO HalogensO Alkaline Earth MetalsO Alkali MetalsTransition Metals is metal and plastic beads magnetism, state of matter, or solubility?please help!!!! 15. Sandra decided to talk a walk at her neighborhood park. She walks 20 meterseast, 40 meters west, and finally 50 meters east. What is her total distanceand displacement, respectively? Examine the equation.3x + 18 = 7xWhat could you do to isolate the variable term to one side of the equation? What is the value of when x=15 Which of the following is a name representing many women who helped in the war effort? Draw the structures of the starting materials needed to make 2methylhept3yne or 2methyl3heptyne. The starting materials may be any bromoalkane having five carbons or fewer. if yall could quickly check the bottom portion and tell me if it's right or not thank you I will give you the brain list !