A car traveled from Indianapolis, Indiana to Miami, Florida at an average rate of 70 miles per hour. The distance was 1,203 miles. About how long did the trip take?Immersive Reader
(1 Point)
About 17 hours
About 22 hours
About 24 hours
About 32 hours

Answers

Answer 1

Answer: About 17 hours

Step-by-step explanation:

1,203/70=17.18571429

17.18571429 is about 17 hours


Related Questions

hey ms or mr could you help me out with this problem please? ​

Answers

N would equal 3 :) shshshsh

Answer:

3

Step-by-step explanation:

We can approximate that triangle B is half the size of triangle A. We know this because the base for triangle A is six, meanwhile, for trinagle B it's 3. With this info we can then assume that in triangle A it's 10 for one side so, for triangle B it must be 5. However, there is n+2 instead. We can use the algebretic equation: 5=n+2. Once this equation is solved the answer is 3. Thus, n = 3.

Mrs. 1 ran 10 meters in 3.8 seconds. Mrs. 2 ran 10 meters in 3.2 seconds.
Who ran faster?

Answers

Answer:

Mrs. 2

Step-by-step explanation:

3.2 seconds is shorter than 3.8 seconds

Answer:

Mrs 2 ran 10 meters in 3.2seconds

Find the value of y,please help

Answers

Answer:

4.5255

Step-by-step explanation:

Use the Pythagorean theorem (a²+b²=c²) where A and B are equal to 3.2

Antonio purchased adult and child tickets for the fair. Tickets cost $29.35 for each adult and $17.45 for each child. Let x represent the number of adult tickets purchased and y represent the number of child tickets purchased. Write an expression to represent the total cost of the tickets Antonio purchased

Answers

Answer: B

Step-by-step explanation:

It is $29.35 for each of the tickets that they buy for adults, so to figure out how much it is for all the adult tickets, it would be $29.35 times x. Same for the children tickets except it is times y and the amount of money is different.

log(5t)(5t + 1) * log(5x+1) (5t + 2) * log(5t+2 )(5t + 3)... log(5t+n)(5t +n +1)​

Answers

I assume you're referring to the product,

[tex]\log_{5t}(5t+1)\cdot\log_{5t+1}(5t+2)\cdot\cdots\cdot\log_{5t+n}(5t+n+1)[/tex]

Recall the change-of-base identity:

[tex]\log_ab=\dfrac{\log_cb}{\log_ca}[/tex]

where c > 0 and c ≠ 1. This means the product is equivalent to

[tex]\dfrac{\log(5t+1)}{\log(5t)}\cdot\dfrac{\log(5t+2)}{\log(5t+1)}\cdot\cdots\cdot\dfrac{\log(5t+n+1)}{\log(5t+n)}[/tex]

and it telescopes in the sense that the numerator and denominator of any two consecutive terms cancel with one another. The above then simplifies to

[tex]\dfrac{\log(5t+n+1)}{\log(5t)}=\boxed{\log_{5t}(5t+n+1)}[/tex]

Need brief explanation about why false is correct

Answers

We are given the equation:

(a + b)! = a! + b!

Testing the given equation

In order to test it, we will let: a = 2 and b = 3

So, we can rewrite the equation as:

(2+3)! = 2! + 3!

5! = 2! + 3!

We know that (5! = 120) , (2! = 2) and (3! = 6):

120 = 2 + 6

We can see that LHS ≠ RHS,

So, we can say that the given equation is incorrect

what is the equation for (4, 9.4) and (-3, -9.5)

Answers

Answer: I got an eqaution I hope it is basic

Step-by-step explanation:

4 times 9

9 - (-3 ) times -9 + 5

Please help me out quickly

Answers

Answer:

I dont see the stuff I think my internet is slow but I will help you when its up again im using hotspot just remind me

Step-by-step explanation:

Nineteen and four hundred fifteen thousand in word form

Answers

Answer: 19,415,000

I think

Step-by-step explanation:

Hope this helps!! :)

Answer:

If I understand what your trying to do, id think it would be 19,415? (IF IT IS IN THE MILLIONS, IT MAYBE 19,415,000 ALSO!)
I may be wrong, but I hope I helped!

Calculate the paychecks of the following people. Select the total hours and paycheck.

Answers

Answer:

If the numbers under the days of the week are the hours worked then the answers are Sue-40,$6.75,$270 Jerry-30,$5.15,154.5  Sam-38.75,$8.75,339 Step-by-step explanation:

Just add up the number of hours worked and multiply by the rate.

What is the point-slope form of the equation of the line that passes through the point (-3,-4) and has a slope
of 2?

Answers

Answer:

y=2x+6

Step-by-step explanation:

Answer:

y=2x+2

Step-by-step explanation:

To find the point-slope form of the equation we need to get the slope-intercept form of (-3,-4) and 2

(Slope intercept form formula is y=mx+b) (m is slope) (b is y-intercept)

So we know that the slope of this equation is 2 so we can replace m with 2 since the slope is 2 and m is slope.

Equation will look like this:

y=2x+b

Now we need to find the b or y-intercept of the equation to do this the (-3,-4) come into play: replace x with -3 and replace y with -4

(x,y) -3 is x since it is the same spot in (-3,-4) and -4 is y since it is in the same spot in (-3,-4)

Replace:

-4=2(-3)+b

Multiply 2 and -3:

-4=-6+b

Move 6 to the other side by adding 6 on both side:

6-4=-6+6+b

Simplify

2=b

Now the equation looks like this: (If you replace b with 2 in y=2x+b)

y=2x+2

Answer: y=2x+2 (Point-slope form is the same thing as slope-intercept form)

a square and rectangle are shown below the width of the rectangle is the same length at a side of the square both represented by x the length of the rectangle is one foot more than twice its width the perimeter of the rectangle is 26 feet more than that of the square write an expression for the length of the rectangle in terms of x label of the drawing

Answers

Answer:

The answer for the length of the rectangle in terms of x is 2x+1=26

Step-by-step explanation:

compare:

-5/6 is greater than or less than or equal to 2/3​

Answers

Answer:

less than

Step-by-step explanation:

Answer:

-5/6 is less than to 2/3

What is the recursive formula for this sequence? 12, 16, 20, 24, 28, ...​

Answers

Answer:

A

Step-by-step explanation:

first term is 12, and following terms are obtained adding 4 to previous term.

look at picture and answer ASAP

Answers

Answer:

its B and A

Step-by-step explanation:

Answer:

its in between the fist and second one cuusing what is given thats what i figured out

Step-by-step explanation:

3 x 36= 108 / 3 x 15 = 45

9 x 12 = 108 / 9 x 5 = 45

6 x 18 = 108 / 6 x 7 = 42

i hope this helps :)

- A beaker is filled with 0.23 liter of water. Leon
fills another beaker with 3 times as much
water. How much water is in Leon's beaker?
A 0.96 liter
B 0.84 liter
C 0.69 liter
D 0.47 liter

Answers

Answer:c

Step-by-step explanation:

A computer manufacturer has found that its expenditure rate per day (in hundreds of dollars) on a certain type of job is given by where x is the number of days since the start of the job. Find the expenditure if the job takes 8 days.

Answers

Answer:

The expenditure would be $ 8600

Step-by-step explanation:

If the cost is given by the function

C(x)= 10x + 6   where x is the number of days

The cost for 1 day would be

C(1)= 16 *100 = 1600 $  ( the expenses are in hundreds of dollars)

Then Putting x= 8 in the given equation we get

C(8)= 10(8) + 6  

= 86

Multiplying 86 by 100 because expenditure rate per day  is in hundreds of dollars

The expenditure would be $ 8600

Doe has 2 3/8 pounds of hamburger meat. He is making 1/4 pound hamburgers .Does doe have enough meat to make 10 hamburgers

Answers

He doesn’t have enough, he has 19/8 and needs 20/8 for 10 burgers, he’s missing 1/8 :)

Theresa finds a shirt on sale at the store. The regular price of the shirt is $32.00. But there is a 20% off sale today. Theresa remembered that there is 8.1% tax on the sale price of the shirt. What is her final cost?

Question 10 options:

$28.92


$27.67


$29.31


$31.00

Answers

Answer:

Step-by-step explanation:

Given tgat:

Regular price = $32

Discount = 20%

Sale tax = 8.1%

chose the correct one quality to match the real-world situation. Gabe will spend no more than $100.

the answer choices are
a.x ≥100
b.x≤100
c.x>100​

Answers

Answer:

B

Step-by-step explanation:

the other too are stating that Gabe will spend more than or more than/equal to $100

1. Explain and give the formula for the formula for the following properties for segments in a circle.
a. Segments from Chords:

b. Segments from Secants:

c. Segments from a Secant and Tangent line:

2. Explain what a radian is and how it relates to a degree.


3. Define the following terms.
a. Inscribed Circle of a Triangle:
b. Incenter:
c. Circumscribed Circle of a Triangle:
d. Circumcenter:

Answers

Answer:

see explanation

Step-by-step explanation:

1

(a)

If 2 chords of a circle intersect then the product of the measures of the parts of one chord is equal to the product of the measures of the parts of the other chord.

(b)

If 2 secants are drawn from an external point to a circle then the product of the measures of one secant's external part and the entire secant is equal to the product of the measures of the other secant's external part and that entire secant.

(c)

If a tangent and a secant are drawn from an external point to a circle , then the square of the measure of the tangent is equal to the product of the measures of the secant's external part and the entire secant.

2

A radian is defined as the angle subtended at the centre of a circle by an arc equal to the radius of the circle.

1 revolution = 360° = 2π radians

1 radian = [tex]\frac{360}{2\pi }[/tex] ≈ 57°

3

(a)

An inscribed circle of a triangle is a circle drawn inside a circle so the circle barely touches the sides of the triangle.

(b)

The incentre is at the point of intersection of the triangle's 3 angle bisectors.

(c)

A circumscribed circle of a triangle ( circles drawn around the triangle so that the circle passes through each of the triangles's vertices.

(d)

The circumcentre is at the intersection of the perpendicular bisectors of the triangle's sides.

'

A sphere has a radius of 4 in. Which equation finds the volune of the sphere?

Answers above on the picture^ thank you:)

Answers

The first one! It’s 4/3 times radius cubed!

Answer:

The first answer

Step-by-step explanation:

1. Given: y = -2x2
Domain
Range
Opening of the
parabola
Vertex
Axis of Symmetry
X - intercept
y - intercept​

Answers

Domain: (-∞,∞) or -∞ < x < ∞ or all real numbers

Range: (-∞,0] or -∞ < y ≤ 0

Opens: Downwards since a is negative

Vertex: ( 0 , 0 )

Axis of Symmetry: x=0

x-intercept: ( 0 , 0 )

y-intercept: ( 0 , 0 )

Using the function h(x) = 2x – 3, what would the input need to be for an output of 7?

Answers

Therefore, the input needed for an output of 7 using the function h(x) = 2x - 3 is x = 5.

What is function?

In mathematics, a function is a rule that assigns a unique output or value to each input of a given set. In other words, a function is a relationship between two sets, called the domain and the range, such that for each input value in the domain, there is exactly one output value in the range. A function can be represented by a mathematical expression or formula, a graph, a table, or a set of ordered pairs. Functions are used to model various phenomena and solve problems in many fields, including science, engineering, economics, and finance.

Here,

To find the input (x) that corresponds to an output of 7, we can set h(x) equal to 7 and solve for x as follows:

h(x) = 2x - 3

Setting h(x) = 7, we get:

7 = 2x - 3

Adding 3 to both sides, we get:

10 = 2x

Dividing both sides by 2, we get:

x = 5

To know more about function,

https://brainly.com/question/28193994

#SPJ1

The vertices of a triangle are P(-2, -4), Q(2, -5), and R(-1,-8). Name the vértices of the triangle after reflecting over the x-axis

Answers

Answer:

P(-2,4)

Q(2,5)

R(-1,8)

Step-by-step explanation:

The rule for reflecting points across the x-axis is to keep the x-value the same but "negate" the y-value. So, the points above are your answers.

Find the volume and surface area of each prism 3cm by 3cm by 3cm

Answers

Answer:

3 x 3 x 3= 18  so 18cm squared

Step-by-step explanation

Answer:

Volume =27cm³

Total surface area=54cm²

Step-by-step explanation:

Formula for finding volume of an object is Volume =length×breadth×height

so V=3cm×3cm×3cm=9cm²×3cm=27cm³ because the cm is three so it will become cube.

Formula for finding the total subject of an object is T.S.A meaning total surface area=2((length ×breadth)+(length×height)+(breadth ×height))

so it will be 2((3cm ×3cm)+(3cm ×3cm)+(3cm ×3cm)) calculate and if you any problem let me know.

Please help! I will give brainliest!!!!!!

Answers

Answer:

3,10 please give me brainliest i need one more for 5 please please  please

Step-by-step explanation:

An employer's accountant has announced that
the budget for the next year must be cut by 1/3 How much must be cut from the
budget if last year's budget was
$166,245?
A. $11,830
B. $55,415
C. $166,245
D. $498,735

Answers

I think it’s c hope that’s helped


What is the slope of a line parallel to the line whose equation is 2x+y=6.

Answers

Answer:

-2 is the slope...

So Basically -2/1

Step-by-step explanation:

Answer:

-2

Step-by-step explanation:

First, you solve for y by subtracting 2x from both sides of the equation and so now we have a y= -2x+6. The slope is going to be the number that is with x.

How do solve this problem?
find an equation of a line parallel to the given line and contains the given point. Write the equation in slope–intercept form. line 2x + 5y= -10 point (10, 4)

Answers

Answer:

y=-2/5x+8

Step-by-step explanation:

Step 1: Begin by changing the equation into slope-intercept form. Subtract 2x to both sides to get 5y=-10-2x. Divide 5 to both sides to isolate the variable, y. You should get y=-2/5x-2.

Step 2: Because we are looking for a line parallel to the given line, the slope should be the same, but the y-intercept should be different. Remove -2 to replace it with b, so it's unknown. The equation should be y=-2/5x+b. Plug in the ordered pair, (10, 4), into the equation to get 4=-2/5(10)+b. Multiply -2/5 and 10 to get -4. Add -4 to both sides and b=8. Plug in 8 and your final equation should be y=-2/5x+8.

Other Questions
Transcribe the following DNA strand into mRNA and translate that strand into a polypeptidechain, identifying the codons, anticodons, and amino acid sequence.DNA: CGATACAATGGACCCGGTATGCGATATCC Jake walks to town every fifth day. Sam rides his bike to town every fourth day. What is the first day they are likely to meet in town? Why do numA and numB have the same scope in the subtract function? def subtract(numA, numB): return numA - numB def divide(numC, numD): return numC / numD answer = subtract(24,6) print (answer) The coda is considered to be Which process is best illustrated by the diagram? Billy has a gift card with a $160 balance. He buys several video games that cost $40 each. After the purchases, his gift card balance is $40. Enter an equation to help find out how many video games Billy bought. Which fraction is represented by point A on the number line? who want to play among us Celeste transferred 100 percent of her stock in Supply Chain Company to Marketing Corporation in a Type A merger. In exchange, she received stock in Marketing with a fair market value of $562,000 + $562,000 in cash. Celeste's tax basis in the Supply Chain stock was $1,320,000. What amount of loss does Celeste recognize in the exchange and what is her basis in the Marketing stock she receives? QUICKLY PLEASE!!!Respond to the following in three to five sentences.What is the purpose of netiquette guidelines? In an experiment, two unknown compounds (one an ether and the other an amine) of equal molecular mass were dissolved in water. The result of the experiment is shown in the table.Solubility ComparisonUnknown Compound Solubility (g/100 ml water)A 4B 0.25Which of the following correctly explains the identity of Compound A and its solubility? It is an amine; it contains a nitrogen atom that will allow nitrogen-hydrogen bonds to form while in water. It is an ether; because the oxygen atom is within the carbon chain, so it is free to form oxy-hydrogen bonds to make it more soluble. It is an ether; the high polarity of the oxygen-hydrogen bond makes it more soluble. It is an amine; because the lower electronegativity of N than H makes it more soluble. . Why is spell check not completely reliable as an editor? is francium found in nature or lab? what is a film interpretation The students are trying to raise 3.000 but they only have 1200 how much would they need to get to 3000 According to the graph below, at which point is the plant preforming the most photosynthesis? A. Point D. B. Point B. C. Point C. D. Point A. How did African American life compare to the typical white person's life in the 1950's? What is the main idea of the section "Controversy and Dissent?Please help!!! Which setting would an author most likely use to show that the protagonist isrebelling against society's rules?O A. A medieval castle that is protected by knights who have a strictmoral codeO B. A lawless town in the future where everyone looks out for his owninterestO C. A contemporary setting in a small town in NebraskaOD. A country in the future where every person is implanted with atracking device will you still have want to 1/2 6 with me