A plant that is heterozygous for a characteristic has two different alleles for that characteristic. Which trait did heterozygous individuals show in Mendel's experiments on pea plants? A. The acquired trait B. The dominant trait C. The codominant trait D. The recessive trait​

Answers

Answer 1

Answer:

the dominant trait

Explanation:

a p e x

Answer 2

B doniment

Explanation:


Related Questions

How does a new cell become specialized into a heart cell?

Answers

The new cell has to have the “code” as in the same DNA as the heart cell so it become a heart cell and if it don’t have the same “ code “ your body will reject the new cell

A new cell become specialized into a heart cell when its structure can be changed into a heart cell.

When the cell become specialized into heart cell by changing its structure, it will be able to do the function properly. Cell differentiation is that process in which cells become specialized into different types of cells such as heart cell, liver cell etc. A stem cell is an unspecialized cell that change into specialized cells under specific conditions which force the unspecialized cell into specialized cell.

When the heart needs more cells then the stem cells start converting into heart cells by changing its form and structure. These specialized cells go to the place where they are needed the most and start their work so we can conclude that new cell become specialized into a heart cell by changing its structure.

Learn more: https://brainly.com/question/19209945

Please help if you know these answers to the water cycle part1

Answers

Answer:

Explanation:

1 is water cycle

2 is biosphere

Propane is burned to provide the heat in many cooking grills. The chemical
reaction for this process is shown in the equation below.
C3Hg +502 + 3 CO2 + 4H20 + energy
What are the products in this chemical reaction?
A. 3C02 + 4H20+ energy
B. C3H3 + 3C02 + energy
C. C3Hg + 502
O D. 4H20 + 502

Answers

Answer:

the products are shown in answer A

Explanation:

Most of the reactions of burning organic substances lead to the products CO2 and H2O and are exothermic.

Which device was not invented in the early 1900s?

Question 7 options:

A)

Electric vacuum cleaner


B)

Electric refrigerator


C)

Electric toaster


D)

Electric car

Answers

Explanation:

Electric Vacuum cleaner- 1901

Electric Toaster- 1893

Electric refrigerator- 1913

Electric car - 1884

Answer: Electric Car

Which of these is the representative organism for roundworms?
Snail
Spider
Leach
Sponge
Sea star
Coral
Roundworm
Fish

Answers

it would be a leach

hope this should help

Increased numbers of CAG repeats in the exon of a gene is associated with certain diseases. In a specific gene, the existing CAG codons are in the 'zero' reading frame, in- frame with the AUG initiation codon. The effect of increased numbers of CAG repeats on the encoded protein is:___________. a. to silence of the gene to generate a truncated protein b. to generate a protein with a run of consecutive glutamines c. to generate a frameshifted protein product d. none of the above

Answers

Answer:

The correct answer is - option b. to generate a protein with a run of consecutive glutamines.

Explanation:

The initiation code AUG is the code for methionine and as well as the initiation code for the particular protein or peptide chain. In this protein, there is a repeat of CAG is increased with the initiation code so, even though they are in zero reading frame they code for their amino acid which is glutamine.

So. an increased number of CAG repeats will result in a protein with the a run of consecutive glutamines.

5.
20. Given the following scenario, choose the best answer that explains
why it happens: The blue dye in the water traveled up the petals of the
white flower.

Answers

As the flower takes water that it needs to survive, the dye in it has no more density so it goes up with the water dying everything in its path blue.

If you do a Gram-stained on a bacteria isolated from a healthy human intestine you will find mostly Gram positive spiral cells.
Select one
True
False​

Answers

I can help you:)

Most bacteria can be stained with postitevly charged stains.So this is true .My friend had a test about this so he told me all about this topic and helped me learn about it and help you.

so there you go :)

Modules Why are fossils an important piece of evidence for evolution? Collaborations?​

Answers

Answer:

they are inportant because they show us how the animal evolved,why, and when. also they gie us clues about modern day animals

Explanation:

If the process illustrated in the diagram is interrupted by a chemical at point X, there would be an immediate effect on the release of

1) Chlorophyll
(2) carbon dioxide gas
(3) nitrogen gas
(4) oxygen gas​

Answers

Answer: oxygen

Explanation:

If the process illustrated in the diagram is interrupted by a chemical at point X, there would be an immediate effect on the release of oxygen gas.

What is chloroplast?

Photosynthesis, the process by which light energy is transformed to chemical energy and results in the generation of oxygen and energy-rich organic compounds, takes place in the chloroplast, a structure found inside the cells of plants and green algae.

Close relatives of chloroplasts that are free-living are photosynthetic cyanobacteria; according to the endosymbiotic theory, these organisms are the ancestors of both chloroplasts and mitochondria, which are eukaryotic cells' energy-producing organelles.

Therefore, If the process illustrated in the diagram is interrupted by a chemical at point X, there would be an immediate effect on the release of oxygen gas.

To learn more about chloroplast, refer to the link:

https://brainly.com/question/11136550

#SPJ2

Volcanic eruptions cause destruction, but they are also

Answers

Answer:

they also form rocks in earth surface

Answer:

Volcanic eruptions may cause destruction but they also create little islands like Hawaii.

The nutrient needed for growth and repair of body tissues is

carbohydrate
protein
mineral

Answers

Answer:

Protein is a nutrient used to make and repair our body cells (like blood and muscle cells). About 1/2 of your dry body weight is protein. If you do not eat enough carbohydrates, protein will be changed to carbohydrates so that you can get energy.

Answer:

protein

Explanation:

The internal urethral sphincter is comprised of

Answers

Answer:

1) the internal urethral sphincter (IUS), which consists of smooth muscle and is continuous with the detrusor muscle and under involuntary control, and 2) the external urethral sphincter (EUS), which is made up of striated muscle and is under voluntary control.

Explanation:

Hope this helped!

What type of electricity ended up being the one we use in homes?

Question 5 options:

A)

DC


B)

AC


C)

Static


D)

Intra-atomic

Answers

Answer:

b

becaus3 tjfjrjfjr tjrjdjdne fjdjd

15.Which of the following contain the genetic code? (Choose one: carbohydrates, nucleic acids, proteins).
16.Which of the following provide the most readily available energy? (Choose one: carbohydrates, lipids, nucleic acids, proteins).

Answers

Answer:

Protiens

Explanation:

because the DNA or RNA is translatted to sequence.

Glycolysis joins glucose to other molecules to make pyruvate. True or false

Answers

Answer:

false

Explanation:

The given statement about glycolysis that it joins glucose to other molecules to make pyruvate is a false statement as glycolysis is a catabolic reaction for glucose molecules.

Glycolysis is the first stage or process of cellular respiration in which -

one glucose molecule is broken down and two molecules of pyruvate are generated.Four ATP molecules also generate, however, two ATP molecules are used, therefore, a net gain of two ATP molecules.It is the fundamental process that takes place in both aerobic and anaerobic (lactate formed instead of pyruvate) cellular respiration.summary of glycolysis

C₆[tex]H_{12}[/tex]O₆ + 2ADP + 2Pi + 2NAD⁺   →   2C₃H₄O₃ + 2H₂O + 2ATP + 2NADH + 2H⁺

On the basis of the given explanation, it is evident that the given statement is a false statement.

Learn more about glycolysis:

https://brainly.com/question/10886602

Biodiversity is a measure of the:

Answers

Answer:

B.

Explanation:

Biodiversity is the diversity (variation) of biology (life). It measures the variation of life within an ecosystem. This directly correlates with B.

Explanation:

combines richness and evenness across species. it is often measured because high biodiversity is perceived a synonymous with ecosystem health

The following DNA is being replicated and the origin of replication is in the middle of the sequence and marked with three stars ***.

5'ATCGGGCTACCCATGAAATGCTAGCATT***TAAGATCTTAAGCTAGCTAGTTCGATCTGA3'

What is the sequence of the primer for the LEADING strand? Your answer should be 8 nucleotides long, written from 5' to 3' and only include the nucleic acid sequence (ex: ACTACTAC).

note: there are two answers for this question

Answers

Answer:

5'GATCGTAA3'

5'ATTCTAGA3'

Explanation:

As requested in the question above, the primers were presented with 8 nucleotides, with the nitrogenous bases of the DNA, and in the 5'-3 'direction.

Primers are small fragments of DNA that are used by DNA polymerase to form new strands. The primes attach to pieces on the ribbon, through the complementarity of the nitrogenous bases, serving as a template for the DNA polymerase to create the new ribbon.

DNA polymerase uses primers at the origin of replication, and can follow the path from the right or from the left, depending on the primers used, for this reason, this question has two answers.


Imagine you were going to model the flow of energy in an ecosystem and the flow of elements in the ecosystem using a diagram
Compare and contrast your diagrams for these two systems.

Answers

Answer:

Only 10 percent of energy is transferred from one trophic to another while the elements transfer are proteins, carbohydrates and fats.

Explanation:

The flow of energy occurs in an ecosystem through a number of trophic. From the first trophic level to the second trophic level only 10 percent of energy is transferred while the rest of the energy is released in the form of heat energy. Flow of elements in the ecosystem refers to the elements that are essential for the survival of organism. These elements are present inside the foods which is eaten by these animals. Proteins, carbohydrates and fats are the elements transfer from one organism to another by eating the food.

Need this asap!!!
The diagram below shows part of the process of DNA transcription. Which
mRNA base will go in location 3?
A.Uracil
B.Thymine
C.Cytosine
D.Adenine

Answers

Answer:B

Explanation:

Answer: as of april 25th 2023 its D

Explanation:

thats what i got and i was right also im pretty sure that they switch the order

Some grass species use the C3 photosynthetic pathway and other grass species use the C4 photosynthetic pathway. As you move from North Dakota to Texas, explain why you think the percentage of grass species using the C4 photosynthetic pathway would increase, decrease, or stay the same.

Answers

Answer:

would increase

Explanation:

C3 plants are those where the first carbon compound produced during photosynthesis have three carbon atoms per molecule (instead of 4 in C4 plants). While higher is temperature and light, oxygen (O2) exhibits a higher affinity for Rubisco, a key enzyme in photosynthesis. In environmental conditions with high temperatures and light such as, for example, Texas when this state is compared to North Dakota, C4 plants tend to be more productive than C3 plants (because these plants have different metabolic pathways). Thus, it is expected that the percentage of C4 plant species in the local grass flora increases as latitude decreases.

It should be noted that the percentage of grass species using the C4 photosynthetic pathway would increase.

It should be noted that C3 plants simply refer to those where the first carbon compound produced during photosynthesis has three carbon atoms per molecule rather than the four carbon atoms that are in C4 plants.

In environments with high temperatures and light such as Texas when this state is compared to North Dakota, C4 plants tend to be more productive than C3 plants. Therefore, it is expected that the percentage of C4 plant species in the local grass flora will increase when there is a reduction in latitude.

Read related link on:

https://brainly.com/question/18766174

PLEASE HELP ASAP IM ON A TIMER!!!
This image shows a volcanic eruption in Hawaii with lava flowing into the sea.

This image shows a volcanic eruption in Hawaii with lava flowing into the sea.

Which statement best describes this eruption?
1. Its magma is high in silica.
2. Its magma has low viscosity.
3. Its gases are released in rapid bursts.
4. Its lava came from an explosive eruption.

Answers

Answer:

4. its lava came from an explosive eruption

Answer:

4 its lava came from and explosive eruption

Explanation:

If we were to take a journey into ourselves, we would find 23 pairs of chromosomes, or ________ individual chromosomes, all packed in the nucleus of each cell.

Answers

Answer: It is 46

Explanation: 23 pairs =46

What is the estimated age of Earth?
A.4.6x10^6
B.4.6x10^7
C.4.6x10^8
D.4.6x10^9

Answers

Answer:

D: 4.6 x [tex]10^{9}[/tex]

Explanation:

4.6 x 10^{9} = 4,600,000,000

Earth is approximately, 4.6 billion = 4,600,000,000 = 4.6 x 10^{9}

The estimated age of Earth is 4.6x10⁹ years (D).

Scientists estimate the age of Earth through various methods, including radiometric dating of rocks and minerals. By analyzing the isotopes present in rocks and minerals, scientists can determine the decay rates of radioactive isotopes and calculate the time since the formation of those rocks.

Based on extensive studies and evidence, the current estimated age of Earth is approximately 4.6 billion years (4.6x10^9 years). This estimation is supported by multiple lines of evidence, including radiometric dating of rocks from different geological formations, lunar samples brought back from the Moon, and meteorites.

The age of 4.6 billion years is consistent with the age of the oldest rocks found on Earth's surface and the ages of the Moon and meteorites, which are believed to have formed around the same time as Earth. These dating methods provide a reliable framework for understanding Earth's geological history and the processes that have shaped our planet over billions of years.

It's important to note that scientific estimates and understanding of Earth's age continue to evolve as new evidence and research emerge. However, the current consensus among scientists is that the age of Earth is approximately 4.6 billion years, as indicated by extensive geological and radiometric dating studies.

To learn more about Earth, here

https://brainly.com/question/31064851
#SPJ2

9. What type of bond is pictured in the image below?

a. covalent bond
b. ionic bond
c. metallic bond
d. electron bond

ONLY 9

Answers

Answer:

c. metallic bond

Explanation:

Metallic bonding, unlike other forms of atomic bonding, involves delocalized elections. The negatively charged electrons form a "sea" around metal cations. Electrons within the valence shells of metals are only held loosely within their molecular orbits- the metals are held together due to the strong attraction between these delocalized electrons and positive nuclei.

The electrons are typically described as mobile, free, and delocalized. These traits are responsible for several metallic properties such as:

electrical conductivityheat conductivityelectronegativitymalleability

Answer: Number 10 is also C

Explanation:

What is the function of a pollen tube?
to lead sperm cells into the ovary
to create more pollen
to create sperm cells
to lead egg cells to the sperm cells

Answers

Answer:

The function of the pollen tube is to lead sperm cells into the ovary.

Explanation:

In angiosperms, the pollen tube is a structure formed when the pollen grain comes into contact with the stigma and germinates, producing a tubal extension that is related to the embryonic sac where the female gametophyte is found.

The function of the pollen tube is to conduct the male gametophyte —which is found in the pollen— to the embryonic sac, in order to come into contact with the oosphere and produce fertilization.

The other options are not correct because the pollen tube:

Do not create more pollen. Do not create more male spermatophytes. Does not lead the eggs to the male spermatophytes.

Answer: to lead sperm cells into the ovary .

Explanation: There needs to be a way for the sperm cells formed by the pollen's generative nucleus to reach the egg cells that are found in the ovary.

What are the major causes for moving air masses in North America

Answers

Answer:

Air masses build when the air stagnates over a region for several days/weeks. To move these huge regions of air, the weather pattern needs to change to allow the air mass to move. One major influence of air mass movement is the upper level winds such as the upper level winds associated with the jet stream.

Explanation:

A major cause for moving air masses in North America is the upper-level winds.

An air mass refers to a large body of air that has identical conditions throughout. It should be noted that air masses take on the condition of the area where they're formed.

Air masses move due to winds and air currents. Moving air masses bring about changes in the weather. The air masses in North America include maritime polar, continental tropical, continental arctic, etc. A major cause for moving air masses in North America is the upper-level winds such as the one that's associated with the jet stream.

Read related link on:

https://brainly.com/question/19087228


Recent research by Ravizza and colleagues suggests that students may spend as much as one-
typical class hour browsing the internet.
half
third
fifth
quarter
Need help on this question?

Answers

Answer:

one-half

Explanation:

According to that study done by Susan Ravizza and her colleagues students spent almost 40 minutes browsing the internet for nonacademic purposes. Since one class period is 100 minutes this would put it at almost one-half of the class period. They also found that the students used their phones for texting for around 27 minutes.

Briefly explain how each layer interacts with electromagnetic radiation from the sun by describing the temperature changes that occur

Answers

Explanation:

The layers of atmosphere are differentiated on the basis of different temperature gradients.Thus,different layers within the atmosphere are created.

Toposphere is heated from the ground. Thus, with increase in altitude temperature decreases.

In the stratosphere, temperature increases with altitude. The direct heat source for the stratosphere is the Sun. Air in the stratosphere is stable because warmer, less dense air sits over cooler, denser air.

In Mesosphere temperature decreases with altitude. Few gas molecules present in mesosphere absorb sun's radiation.The heat source is the stratosphere below. The mesosphere is extremely cold, especially at its top, about -90°C.

Thermosphere which also contains ionosphere.The density of molecules is so low in here that one gas molecule could easily go upto 1 km before it collides with another molecule. It is so little energy is transferred, the air feels very cold

If cells were a school building, the cell membrane would most likely be represented by which of the following?
А
intercom
B
lockers
С
teachers and students
D
walls and doors

Answers

d-walls and doors would represent the cell membrane
Other Questions
The State of Adaven issued $50 million of perpetual bonds in 1990. The bonds were issued in $100 denominations with an annual coupon interest rate of 5%. Determine the rate of return or current yield on these bonds if they are purchased at the current price of $40.a. 12.5%.b. 8.0%.c. 5.0%.d. 1.25%. What was the population of the Aztec empire? HELP ASAP?!?!?!? QUADRATIC REGRESSION MODELSMake a scatter plot of the data below (10,12.5) (20,36) (30,69.5) (40,114) (50,169.5) (60,249) (70,325.5) Use the quadratic regression feature of a graphing calculator to find a quadratic model. Round to the nearest hundredths place. increased amounta of carbon dioxide in Earth's atmosphere may lead to global warming. what might global warming then lead to When a potential difference of 10 V is placed across a certain solid cylindrical resistor, the current through it is 2 A. If the diameter of this resistor is now tripled, the current will be:______.A) 18 A.B) 2/3 A.C) 3 A.D) 2/9 A.E) 2 A. Which is the better buy?2-quart carton of pineapple juice for $2.007-cup carton of pineapple juice for $3.01 i really need help and fast The wind around a surface low pressure in the Northern Hemisphere blows __. a. counterclockwise perpendicular to isobars.b. clockwise perpendicular to isotherms. PLZZZZZZZZ HELP WILL MARK YOUPLZZZZZZZZZZZThe table below shows the amounts of lime juice and sugar used in each container of limeade. The ratio of lime juice to sugar is 1:r, where r is the unit rate. Use the table to determine r.Lime Juice Sugarone-fifth cup 1 cup2 cup 10 cup3 cup 15 cup ANSWERS one-fifth 4 two-thirds 5 Select the correct answer.Which sentence best explains the authors choice for structuring this passage? i think of a number x double it add eleven i get 25 What happened on July 4th? *1. Congress declared war on Great Britain2. Congress published the Declaration of Independence3. Congress voted to accept the Declaration of Independence santa arrived at the party just to the nick of time, please find the pun and gimme me the 2 meanings of the pun! The current balance of Ambers bank account was $8. She withdrew $14. Find the new balance in her account. Why doesn't the glassblower tell the truth to the wizard? Angle A measures 4x + 40 degrees and angle B measures x 10degrees. If angles A and B are complementary, what is themeasure of angle B? What was the interest rate if your balance on an investment of $669 at the end of two years is $709.14? 21. A fertilized egg (embryo) attaches itself to the lining of thewhere the fetus develops.vaginabladderurethrauterus I have no idea what I'm doing A research scientist wants to know how many times per hour a certain strand of bacteria reproduces. He wants to construct the 95% confidence interval with a maximum error of 0.09 reproductions per hour. Assuming that the mean is 6.6 reproductions and the variance is known to be 4.84, what is the minimum sample size required for the estimate? Round your answer up to the next integer.