Why doesn't the glassblower tell the truth to the wizard?

Answers

Answer 1
Because the glassblower was the imposter.

Related Questions

PLEASE HELP

If guinea pigs, black fur is dominant over white fur. Which of the following alleles could represent the gene for white fur? Hint we use the letter of the dominant trait
B b W or w?

I strongly belive its W Please let me know

Answers

Answer:

...

Explanation:

Identify the structure labeled X in the diagram

Polypeptide (protein) made up of amino acids

DNA make up of nucleotides

DNA made up of amino acids

Messenger RNA made up of nucleotides

Answers

Answer:

first one

Explanation:

DNA is what is in the nucleus not outside and mRNA is the bottom

1. A piece of pure gold (Au) has a volume of 50 cmWhat is its mass?
Density of Some Metals
Metal
Density (g/cm3)
Copper
8.96 (g/cm)
Iron
7.87 (g/cm)
Lead
11.36 (g/cm)
Magnesium
1.74 (g/cm)
Silver
10.49 (g/cm)
Zinc
7.13 (g/cm)
A. 0.38 g
B. 2.63 g
C. 69.3 g
D.950 g

Answers

Answer:

96.5g

Explanation:

Given parameters:

Volume of Au = 50cm³

Density of Au = 19.3 g/cm³

Unknown:

Mass of the  gold  = ?

Solution:

Density is the mass per unit volume of a compound.

 Density  = [tex]\frac{mass}{volume}[/tex]

 Mass  = density x volume

Insert the parameters and solve;

   Mass  = 19.3 g/cm³ x 50cm³  = 96.5g

Brainliest to the correct answer...plz anser if you know and not just for points

Answers

Answer:

i would say false because tree slow down erosion not speed it up

Explanation:

hope this helps :)

Correct answer?
False

What water cycle process moves water from land to streams

Answers

The answer should be runoff.

Answer:

The answer would be runoffs

Explanation:

Although water coming from land to streams isn't directly tied to the water cycle, runoffs are due to gravity.

May I have brainliest please? :)

What is the correct answer?

Answers

Answer: it has to to be the last one one cause i added all the numbers and got 1,200 but when i sutracted them i did get those numbers so it must be the last one

Explanation:

I also think the last one:)

what are the most common types of organisms in the ecosystem.

Answers

Answer:

producers, consumers and decomposers. They are all important parts of an ecosystem. Producers are the green plants.

Explanation:

Hope this helps

*
How many copies of DNA are made when replication is complete?
14 points
O A4
B3
C2
D 1

Answers

C.2
.........................

Q1. Name the following:

(i) Narrow blood vessel whose walls have a single layer of cells

Answers

Answer:

i think just google it for the answer

Answer:

Artery

Explanation:

Tunica Intima

In smaller arterioles or venules, this subendothelial layer consists of a single layer of cells, but can be much thicker in larger vessels such as the aorta. The tunica intima is surrounded by a thin membrane comprised of elastic fibers running parallel to the vessel.

When you mix salt with water in a beaker, the salt is no longer visible. What
happens to the salt?
A. The salt changes state from a liquid to a gas.
B. The salt reacts with the water to make a new substance.
C. The salt dissolves in the water.
D. The salt is destroyed by the water.

please help, i’ll mark brainliest if you get it right! please please only answer if you know the answer though, don’t guess i’m taking a test and i can’t fail as it’s the last one before the quarter ends ( tomorrow ) id appreciate it!! thank youuu

Answers

Answer:

C. The salt is dissolved by the water

Explanation:

When ionic compounds dissolve in water, the individual ions separate and get surrounded by water molecules—a process called solvation. Because the salt ions are charged, they dissolve much better in a polar solvent, which is also slightly more charged than a nonpolar solvent

Hope this helped, Have a Great Day!!

If there's anyone who took the test, please help!
What results when there is very heavy competition between the two species?
A) interspecific competition
B) competitive exclusion
C) coexistence
D) evolution

Answers

Answer:

it's D

Explanation:

This is because heavy competition drives natural selection which increases evolution.

Choose the term that best matches the description given.

Cells that engulf and destroy bacteria _____________.

Answers

[tex]\huge\color{pink}{\underline{\underline {Question}}}[/tex]

Choose the term that best matches the description given.

Cells that engulf and destroy bacteria _____.

[tex]\huge\color{pink}{\underline{\underline {Answer}}}[/tex]

Cells that engulf and destroy bacteria phagocytes.

Answer:

Cells that engulf and destroy bacteria is " Phagocytes"

Which of the following statements is true of both binary fission and mitosis?

a.) They both produce four daughter cells with one set of chromosomes.
b.) They both produce two daughter cells with complete DNA.
c.) They both are used primarily for asexual reproduction.
d.) They both involve the division of a single nucleus.

Answers

Answer:

i think c is the right answer

Answer: B

Explanation:

What happened when Earth's first atmosphere collapsed? Will mark you as brainliest!

- it created oxygen

-it formed the oceans

-it triggered an ice age

-it fell as rain, watering the earliest plants

Answers

Explanation:

solar radiation would break atmospheric water into oxygen, which would react with carbon on the Earth to form carbon dioxide. The air would still be too thin to breathe. The lack of atmosphere would chill the Earth's surface.Plants and land animals would die

In this project, you will be designing three graphs based on the information given to you in tables. You must organize the information into graphs and make them clear and understandable. For help on the graphs, go back and read the section in your text on graphing. If you are creating a digital graph your teacher may provide resources or tools to guide you through the digital application. When submitting your graphs make sure to answer the following question for each graph.

Did you finish your line or bar graph?
Did you draw your graph or create a digital graph?
Describe your results.

Did you finish your pictograph?
Did you draw your graph or create a digital graph?
Describe your results.

Did you finish your pie chart?
Did you draw your chart or create a digital chart?
Describe your results.

Answers

Answer:

I tried but I could not get if

Explanation:

try Google or any other app

What sea creature is this?

Answers

Answer:

i wanna say a stingray but im not 100% sure

Explanation:

That is a stingray.

Recall what you know about nervous tissue to answer the following questions. Nervous tissue can generate and conduct ____ signals that control the body.
answer choices are:
chemical
electrical
thermal

Answers

Answer:

Nervous tissue can generate and conduct electrical signals that control the body.

Explanation:

The neuron is the specialized cell that provides function to nerve tissue. Given the structure of the neuron, this cell is capable of creating and conducting information in the form of electrical impulses or signals, by depolarizing its cell membrane and generating action potentials.

The information generated and transmitted by the neurons allows the nervous system to obtain internal and external information of the organism, as well as to control all the body functions.

    The other options are not true because nerve tissue does not generate or conduct thermal or chemical signals to perform its function.

Answer:

Part 1: electrical

Part 2: A, B, E

Explanation:

did it on edg.

Read the article and use the information to answer the question that follows.

Forensic DNA

How can DNA be used to help solve a crime?

Answers

Answer:

Each person’s DNA is unique.

Scientists use variable regions in DNA to create a DNA profile.

DNA samples can be taken from blood, bone, hair, or other body tissues and

products.

DNA from a crime scene can be compared to DNA from a suspect.

DNA typing can be used to solve old cases.

Explanation:

edge 2021

DNA can be used to solve a crime as the sample of the DNA of a person can be compared to the evidence that's gotten from a crime scene.

Deoxyribonucleic acid which is commonly referred to as DNA is the molecule that has all the information that's vital to build an organism.  Each person’s DNA is unique.

DNA contains the genetic information of everyone. DNA samples can be taken from blood, bone, hair, or other body tissue.

To solve a crime, DNA from a crime scene can be compared to DNA from a suspect. If the DNA collected is the same as the one that's seen at the crime scene, then it shows that the person is responsible for the crime.

Read related link on:

https://brainly.com/question/19276361

Carbon, nitrogen, and phosphorus are examples of what?

Answers

Answer:

A natural process in which elements are continuously cycled in various forms between different compartments of the environment (e.g., air, water, soil, organisms).

Hope this helps!

Answer:

Carbon Cycle. Nitrogen cycle. Photsphorus cycle. Water cycle. The carbon cycle includes the uptake of carbon dioxide by plants through, its ingestion by animals and its release to the atmosphere through respiration and decay of organic materials.

Explanation:

A natural process in which elements are continuously cycled in various forms between different compartments of the environment (e.g., air, water, soil, organisms). Examples include the carbon, nitrogen and phosphorus cycles (nutrient cycles) and the water cycle.

Besides helping to discover the structure of DNA, describe two other contributions Rosalind Franklin made to the world of science.​

Answers

Answer: Rosalind Franklin discovered the density of DNA and, more importantly, established that the molecule existed in a helical conformation. Her work to make clearer X-ray patterns of DNA molecules laid the foundation for James Watson and Francis Crick's suggestion that DNA is a double-helix polymer in 1953.

Explanation:

Rosalind Franklin made numerous contributions to science in addition to helping to discover the structure of DNA, and in the field of virology, in coal-based materials, by using X-ray crystallography, in agriculture, etc.

What is the contribution of Rosalind Franklin?

She was one of the greatest scientists who made significant contributions to the field of DNA by using X-ray crystallography, and apart from that, she also made contributions to the field of virology. As X-ray diffraction facilitates the study of the structure of viruses such as the tobacco mosaic virus and the polio virus and helps in understanding the replication of viruses, it is also helpful in the study of the structure of coal and other carbon-based materials.

Hence, Rosalind Franklin made numerous contributions to science in addition to helping to discover the structure of DNA, and in the field of virology, in coal-based materials, by using X-ray crystallography, in agriculture, etc.

Learn more about Rosalind Franklin here.

https://brainly.com/question/6707318

#SPJ2

When we breathe, we inhale oxygen and release carbon dioxide. What cell process does our body use the oxygen for?

A. Photosynthesis

B. Cellular respiration

C. Osmosis

Answers

Answer:

Cellular respiration

Explanation:

This is because if you see Photosynthesis is used for plants to get a food source from the Sun. Osmosis is the movement of chemicals from a less converted membrane to a more. I think i said that wrong but. I am sure it is cellular respiration which is the despirsion of waste products. So yeah Answer is Cellular respiration

Which of the following words means limp or lacking in turgor?

Answers

The answer is flaccid

During an experiment to determine if people with more symmetrical body features have a lower incidence of disease, a researcher first measures the length of several bones in the subject's hands and arms. The device used to measure length does not display a readout of the measurement taken. Instead, a wire connects the measuring device to a computer that records the data. The computer monitor is kept out of sight of the subject and the researcher. Why is such an elaborate device used?a. So that the subject will not know if he or she is part of the control group.b. So that the experiment will be repeatable.c. So that the subject will not be injured by the experiment.d. So that the identity of the subject will remain anonymous.e. So that the measurements are not biased by the researcher.

Answers

Answer:

e

Explanation:

The main reason such an elaborate device was used would be to eliminate any element of bias by the researcher.

It is important to eliminate biases when taking measurements so as to ensure the accuracy of the data and the overall outcome of the experiment. If a simpler device had been used in which the researcher manually records the length of the bones, it is possible to knowingly or unknowingly introduce biases or random error into the experiment which will impact the integrity of the data and the outcome of the experiment.

The correct option is e.

Describe the phases of the moon.

Answers

Answer:

Here

Explanation:

Answer:

Waxing Cresent ( when the moon is growing in size to reach it's maximum fullness), FIrst Quarter (When the moon is one quarter full), Waxing Gibbous (When the moon is over half full), Full Moon (When the moon is completley full), Waning Gibbous (When the moon is almost half dark), Last Quarter (When the moon is half dark), Waxing Cresent (When the moon is a small cresent shape in the sky), New Moon (When the moon is completley dark)

Explanation:

Hope this helps!! :)

Which is the best hypothesis for the scientific question “How does light intensity affect the rate of photosynthesis?”

Answers

Answer:

A hypothesis for this question could be: If there is more light intensity on a plant then, there would be higher rates of photosynthesis.

Explanation:

Answer:

The answer to this question would be C.) If the distance between the source of light and the plant is increased, the rate of photosynthesis will decrease.

Explanation:

Hope this helps :) !!!!!!!!!!!!!!!!!

Please push that thank you button and have a good day !!!!!!!!!!!!!!!!!!!!

what are nutrients and water absorbed by?

Answers

Answer

Your lower intestine of your body

Which of the following is true regarding tissue?
a)
An example of tissue is the digestive system, which helps break down food
particles for organisms to obtain energy and nutrients.
Ob) Tissue is a group of specialized cells that work together for a common
function and form organs.
O c) Sponges are the only animal made of tissue and made of haploid cells.
d) Tissue is a group of diploid molecules bonded together chemically.

Answers

Answer:

True: b) Tissue is a group of specialized cells that work together for a common  function and form organs.

Explanation:

Cells are the smallest units of life, they may be either unicellular or multicellular. Unicellular organs have a single cell capable of carrying out all of the functions necessary for its survival. Multicellular organisms are more complex, and require the work of multiple different cell types.

Their cells become differentiated- where they undergo certain processes to become specialized, and gain maturity. Groups of specialized cell types form tissue; these each have varying functions over time. Organs consist of two or more tissue types that are specifically organized to carry out a function.

Answer:

b) Tissue is a group of specialized cells that work together for a common

function and form organs.

Explanation:

Sponges are the simplest type of animal therefore they have a few different features than other animals. Like all animals, sponges are diploid, multicellular, heterotrophic, reproduce sexually, mobile, and don't have a cell wall. They are different in that their zygotes do not form into a blastula and they are not made of tissue.

Also, i took the quiz :)

Food is moved through the esophagus into the stomach by
involuntary muscle contractions called?

Answers

Answer:

peristalsis

Explanation:

when food contracts down the esophagus

Answer:

peristalsis

Explanation:

3. What does the heading
represent?

Answers

Do you have a photo of the problem? :)

The diagram shows a reflex arc. Name parts P and Q shown on the diagram above.
Please help.

Answers

Answer:

P - synapse

Q - Relay neuron

Explanation:

A synapse, easy to remember as a neural junction, is the site where the transmission of electric impulses occurs. This occurs between two neurons or between a neuron and a gland or muscle cell. So in this scenario when we poke the finger it fires an electric nerve impulse that gets to the P spot that is a synapse and gets transmitted to the relay neuron. A relay neuron is there to receive the signal from one neuron and then transfer it to another interneuron resulting in the signal being received by a motor neuron so that we can react to the stimulus.

Other Questions
What is the unit rate of 232 people in 8 classrooms? i need help with this pleasee five men build a wall in 10 days how long will it take 10 men Anchara drops a penny from a height of 60 feet above the ground. The equation h=-16t^2 + 60 models the penbys height h i feet as a function of time t in seconds whatvare the solutions P3- is a(n) ______________________, so it ________________ valence electrons. Group of answ er choices anion, gained cation, gained cation, lost anion, lost The following DNA is being replicated and the origin of replication is in the middle of the sequence and marked with three stars ***. 5'ATCGGGCTACCCATGAAATGCTAGCATT***TAAGATCTTAAGCTAGCTAGTTCGATCTGA3'What is the sequence of the primer for the LEADING strand? Your answer should be 8 nucleotides long, written from 5' to 3' and only include the nucleic acid sequence (ex: ACTACTAC).note: there are two answers for this question A farmer's market is selling peaches for $2.00 a pound. If you buy 2 pounds, you save 10% on each pound. How much does it cost to get 2 pounds of peaches? 1. What right do education encompasses both entitlements and freedom?A. Right to free and compulsory primary educationB. Right the quality education in private schoolC. Right to choose yourteachersD. All of the above2. Which of the following is an example of non-formal education?A. Primary schoolingB. Senior high schoolC. Adult night classesD. Doctorate program El libro. _____ Libros. Approximately how many people are likely trafficked into the United States each year?5,5008,5008,50011,50011,500-14,500O 14,50017,500 She dove 75 feet under the sea To be eligible for Bright Futures, you must submit a statement explaining how all money will be repaid submit a plan of action for all courses throughout college take at least three remedial credits in the first semester take at least six non-remedial credits per semesterplease only answer if you know what your talking aboutand if your right i will give brainiest. What was the biggest drawback of Chinese block printing? In a perfectly insulated container of negligible mass, 4.00 102 kg of steam at 100C and atmospheric pressure is added to 0.200 kg of water at 50.0C. A) If no heat is lost to the surroundings, what is the final temperature of the system? B) At the final temperature, how many kilograms are there of steam and how many of liquid water? What is the importance of the Battle of Khanua and Chaunsa? VocabularyMake a sentence using these two wordsdedicated, obstaclecollaborate, techniques 3) Complete the sentences. Use the Past Simple or the Present Perfect Simple form of the verbs in brackets1 Marry_____(win) the lottery last year.2 I _____(not see) anyone yet.(come/just) home.4. They____(buy) the car two years ago5. William still____(not buy) the present for his sister 4 Complete the sentences. Use the Present Perfect Simple or the Present Perfect Continuous form of the verbs inbracts1. The baby's face is really dirty. What____(he/eat)?2. Like____(never/be) abroad3. Eva is exhausted these days. She______(work) too hard recently.4.______(you/finish) your homework yet?5. I_____(clean) all morning I'm really tired! 6x = 10y - 10x + y + 7 = 0What is x and y? Kiran and Clare live 28 miles away from each other along a rail trail Kiran walks at a speed of 3 miles per hour while Clare walks 4 miles per hour how long will it take the two friends to meet Choose the correct conjugation of the verb DAR in the following sentence:Ustedes __________ comida por la noche.Group of answer choicesdamosdoydasdan