Answer:
C
Explanation:
____ can be used for different types of surgery.
a. Lenses
b. Lasers
c. Diffractions
d. Refractions
(Lasers)
Answer:
lenses can be used for diffrent types of surgery
Plz help I’ll mark brainliest
Answer:
I'm pretty sure it's exponential growth.
Explanation:
Answer:
expontential growth!!
Explanation:
How is energy released from ATP?
Answer:
food zygote d9gugousfoysocysohcoecu sperm
Answer:
In a process called cellular respiration, chemical energy in food is converted into chemical energy that the cell can use, and stores it in molecules of ATP. ... When the cell needs energy to do work, ATP loses its 3rd phosphate group, releasing energy stored in the bond that the cell can use to do work.
Use the word “capacity”in a sentence.
Answer:
The weight capacity in this elevator is over its limit, somebody is gonna have to step out
How do I fly? :(;):)
Answer:
Hm
Explanation:
Try a few things like an airplane, jetpack, etc
what animals eat leafy sea dragons? also want to do leafy sea dragons eat?
Plants receive carbon dioxide through their ____________.
Answer:
leaves,stomata
Explanation:
The carbon dioxide enters the leaves of the plant through the stomata present on their surface.
Answer:
Carbon dioxide enters through tiny holes in a plant's leaves, flowers, branches, stems, and roots.
Explanation:
What are the DNA strands called?
What is the RNA stand called?
Answer:
it rna means
Ribonucleic acid
Answer:
DNA strands - polynucleotides
RNA strand - nucleotide chain
Explanation:
DNA strands are known as polynucleotides because they are comprised of two nucleotide chains.
RNA is composed of a single nucleotide chain.
Hope this helps :)
A environmental scientist buys 20 gallons of oil eating bacteria to help remediate an area affected by an oil spill. The volume of water the scientist wants to cover with this bacteria is 5 ft³. What volume of water can the scientist cover with the bacteria she purchased? (1 gal = 0.13 ft³)
Answer:
2.6 [tex]ft^3[/tex]
Explanation:
Using the conversion factor:
1 gallon = 0.13 [tex]ft^3[/tex]
Therefore,
20 gallons = 20 x 0.13
= 2.6 [tex]ft^3[/tex]
This means that only 2.6 [tex]ft^3[/tex] out of the 5 [tex]ft^3[/tex] total volume of water the scientist wants to cover can actually be covered by the bacteria that was purchased.
what type of EM waves are used to observe objects from outer space
Answer:
Space telescopes can carry instruments to observe objects emitting various types of electromagnetic radiation such as visible, infrared or ultraviolet light; gamma rays; or x-rays. X-ray telescopes, such as the Chandra X-ray Observatory, use X-ray optics to observe remote objects in the X-ray spectrum.
Explanation:
becuse u ugly jk jk jk im not serious ok
1. When a consumer eats a producer, 10 percent of the producer's energy is passed on to the consumer trophic level. What happens to the other 90 percent?
A. It is added back to the soil by decomposers.
B. It is used by the producer to pass on to the next trophic level.
C. It is used for cell processes or released as heat.
D. It is consumed and used by the consumer.
2. Why is there less biomass at the top of the energy pyramid?
A. Secondary and tertiary consumers have to consume a lot more food to support themselves, so there are fewer of them.
B. Secondary and tertiary consumers live longer, so there are fewer of them because they reproduce more slowly.
C. Secondary and tertiary consumers are larger, so there are fewer of them.
D. Secondary and tertiary consumers have bigger ranges, so there are fewer of them because they each need a lot of space.
3. Using the ten percent rule, determine how many kilocalories of energy the tertiary consumer tuna will receive.
Algae: 135,000 Kcal
Shrimp: _
Lantern Fish: _
Tuna: _
A. 135 Kcal
B. 1,350 Kcal
C. 135,000 Kcal
D. 13,500 Kcal
4. Read the following statements about various species of plants and animals. Which one would be classified as an invasive species?
A. Kudzu, a plant from Japan, was introduced as a foliage crop and to reduce soil erosion. It grows up to a foot per day, smothering low-growing plants and killing trees.
B. Dandelions are plants from Eurasia. They are often considered weeds by homeowners and killed off by using herbicide. They can be consumed in salads or as tea and are the first food resource for bees in the spring.
C. Honey bees are from Europe and can sting people. They are often farmed in America for their ability to pollinate and provide honey.
D. Loosestrife beetles, native to Eurasia, have been released in various American states to combat the invasive plant, purple loosestrife.
5. Using the following formula to find the efficiency of energy transfer between the harbor seal (2,500 Kcal) and a polar bear (375 Kcal)
(Energy level transferred to next level) / (Total energy input) × 100
A. 15%
B. 20%
C. 10%
D. 12%
Thank you so much if you answer this:) I'm working on it and will probably figure them out but a little help would be appreciated. <3
Answer: I just to happen to be working on this quiz right now. I got 5/5 on it, so I hope this helps :D
~Ten Percent Rule Quick Check~
1. B) It is used for cell processes...
2. D) Secondary and tertiary consumers have to consume a lot more..
3. D) 135 Kcal
4. C) Kudzu, a plant from Japan...
5. A) 15%
^This is confirmed valid as of January 17th, 2022^
Consumers are the organisms that depend on others for food and energy for the metabolic process while the producers produce their food at the trophic levels.
The correct options are 1. C, 2. A, 3. A, 4. A and 5. A.
The trophic levels can be explained as:1. In the trophic levels the energy gets decreased as it passes from one level to another because it is used in the cellular process it is released in the form of heat.
2. Secondary and tertiary consumers have to feed a lot and hence, they are fewer in number compared to the producers. They maintain the population and balance out the producer and consumer ratio.
3. According to the 10 % rule of energy transfer, the Tuna will receive 135 Kcal of energy because the energy decrease by 10% as one moves from the lower trophic to the upper levels.
4. The species that are non-native to a place or region are called invasive species hence, the Kudzu plant is the invasive species as it is introduced from Japan.
5. Given,
Energy of Seal = 2,500 Kcal
The energy of polar bear = 375 Kcal
The 10% of 2500 will be 250 and the 5 % 125 thus, 15% is the efficiency.
Therefore, the correct options are 1. C, 2. A, 3. A, 4. A and 5. A.
Learn more about energy transfer and trophic level here:
https://brainly.com/question/20586850
pls help!!
Which row shows the chambers of the heart, from those with the thickest walls to those with the
thinnest walls?
from top to bottom it goes from the thickest to thinnest
A.
atria
left ventricle
right ventricle
B
atria
right ventricle
left ventricle
с
left ventricle
right ventricle
atria
D
right ventricle
left ventricle
atria
Priscilla was building a circuit that used copper wires to connect a battery to a light bulb. As she connected the final wire from the light bulb back to the battery, the light bulb turned on. Priscilla knew that current was now flowing through her closed circuit. What makes the current in the circuit flow?
Answer:
The complete path provided by the closed circuit enables electric current produced by the battery to flow round the circuit
Explanation:
Electric current consists of charges (electrons) in motion from one region to another.
An electrical circuit is any closed path through which electric current can flow.
An electrical circuit consists of an energy source that supplies the electrons moving, a path along which the electrons can travel, and a load or appliance that uses the electrical energy. When the circuit is broken at any point, electrons will cease to flow since there is no complete path for it to flow. Such a circuit is known as an open circuit.
In the circuit built by Priscilla, the battery serves as a source of energy by providing the electrons that moves round the circuit. The wires provides the path for electrons to flow from the battery through the light bulb and back to the battery. When she connected the final wire from the bulb back to the battery, the circuit becomes complete/closed and current then flows to light up the bulb.
Which list the layers of the atmosphere from earth surface outward?
Answer:
In order from earth to space it would be troposphere, stratosphere, Mesosphere, Thermosphere, exosphere (ionosphere.)
Explanation:
^
troposphere, stratosphere, mesosphere, thermosphere
2.3/6.E.2.4 Test 1 2 of 30
Which element causes soil to appear red?
O A. calcium
B. iron
c. magnesium
D. silicon
Answer:
B
because iron appears the color red
Use the following questions to write your conclusion to your lab report.
What did you learn from doing this lab? (Did the volcano have an effect on the ability of a predator to catch their prey? What might this mean for future generations? Include numbers from your data tables to show these changes.)
How could you make the lab better?
Answer:
WHat??
Explanation:
Please Help!
The middle of an mRNA molecule contains the nucleotide sequence shown here. Much more of the mRNA is translated. Assume that the sequence is translated from left to right.
AUUUAACUGUUCUGUCUAGAG
1.
Construct an Explanation Based only on the information provided, why could the mRNA section be translated into three different sets of amino acids, instead of just one set?
2.
Use Models Use the genetic code to translate the sequence into each of the three possible sets of amino acids.
3.
Draw Conclusions Which of the three sets of amino acids is the most likely to be included in the polypeptide? Explain your reasoning.
Answer:
TAA ATT GAC AAG ACA GAT CTC
1. The more bases there are per codon the more information you can code for. There are only 22 different amino acids, in consequence we need minimum 3 bases per codon.
2. codon
three nucleotides—called a triplet or codon—codes for one particular amino acid in the protein. The nucleotide sequence in the DNA is first transcribed into a molecule of messenger RNA (ribonucleic acid).
3. Known as alpha helices and beta sheets, these stable folding patterns make up the secondary structure of a protein. Most proteins contain multiple helices and sheets, in addition to other less common patterns (Figure 2). The ensemble of formations and folds in a single linear chain of amino acids — sometimes called a polypeptide — constitutes the tertiary structure of a protein. Finally, the quaternary structure of a protein refers to those macromolecules with multiple polypeptide chains or subunits.
OKAY I THINK EVERYTHING IS RIGHT BUT SORRY IF WRONG ;)
3. It is not possible to determine which of the three sets of amino acids is the most likely to be included in the polypeptide based solely on the information provided.
What is a nucleotide sequence?A nucleotide sequence is the order of nucleotides (the building blocks of nucleic acids) in a DNA or RNA molecule.
Nucleotides are composed of a sugar, a phosphate group, and a nitrogenous base, which can be adenine (A), cytosine (C), guanine (G), thymine (T) (in DNA) or uracil (U) (in RNA). The specific order of these nucleotides in a DNA or RNA molecule determines the genetic information that the molecule carries.
Learn more about nucleotide sequence, here:
https://brainly.com/question/30299889
#SPJ6
Help (will give crown for answer)
Answer:genes
Explanation:
Based on an analysis of the data, describe the effect of karrikins on seed
germination in the autotrophic host plants and the obligate parasitic weed plants.
Answer:
It triggers seed germination by activating hormone.
Explanation:
Karrikins has a great effect on seed germination in the plants as well as the obligate parasitic weed plants because it trigger the germination of seed by signaling of hormone known as strigolactone which is responsible for the germination of see. Karrikins are the group of plant growth regulators which is present in the smoke of burning plant.
Which of the following could result if meiosis did not occur in the process of sexual reproduction?
What would happen if meiosis did not occur in sexually reproducing organisms? The chromosome number would double in each generation because the process of meiosis halves the number of chromosomes in the gametes. ... the exchange of genetic material between homologous chromosomes that results in recombinant chromosomes.
Hope this helps a bit
PLS HELP ME IM STRESSING RIGHT NOW I JUST NEED HELP ON THIS
Which statement accurately describes a mountain ecosystem?
They usually host three or more ecosystems where animals can’t live.
They usually host one ecosystem with a variety of wildlife.
They usually host one ecosystem with a variety of plants.
They host three or more distinct ecosystems.
Fossils usually occur in metamorphic rock. true or false?
Answer:
false
Explanation:
They can't survive the great pressures metamorphic rocks go through. They usually are only in sedimentary rocks. Hope this helps!
Answer:
false
Explanation:
Fossils are very fragile and metamorphic rocks go through some harsh changes, so i'd be impossible for fossils to stay intact or even form in metamorphic rocks
Which nutrient cycle has no Gas Phase?
Answer:
Describe the steps that you would take to effectively prepare for a discussion about a debatable issue.
Explanation:
Make a food web for the rainforest
Answer:
VEGETERIANS, VEGANS, CARNIVORES, CANNIBALS, Omnivores
Explanation: EVERYWHERE!!
The sun, rocks, water are all example of...
Answer:
are examples of abiotic factors
Explanation:
Bromine is a liquid at room temperature. The volume of a sample of bromine is measured in a 50 ml beaker and a 100 ml beaker. How will the two
measurements compare?
A. The volume of bromine will be larger in the 100ml beaker.
B. The volume of bromine will be smaller in the 50ml beaker,
C. The volumes will be the same.
D. Both A and B
The actual volume of bromine in each beaker will be same only the difference in height will be comparable. Therefore, option (C) is correct.
What are the properties of liquid ?A liquid's attributes are;
1) Compared to the volume occupied by a gas, the volume of a liquid is relatively stable at conditions that allow it to remain in the liquid state.
2) A liquid will take the form of the container it is placed in.
3) A liquid's surface in a container must be flat for the attraction forces between its molecules to be in equilibrium both at the liquid's surface and within its body.
Therefore, there will be variations in the measured height of the same volume of bromine in each beaker given that the volume of the bromine is measured in a 50 ml beaker and a 100 ml beaker.
Learn more about Liquids, here:
https://brainly.com/question/13279941
#SPJ5
Organisms are composed of many complex molecules. These molecules are composed mainly of carbon, hydrogen, oxygen, nitrogen, sulfur, and phosphorus. Which of the following statements most accurately describes how these molecules are made in ALL organisms?
William wanted to create a report on a geographical location with the greatest species diversity. Which ecosystem can he consider for his report?
Answer:
Forest ecosystem or marine ecosystem.
Explanation:
Forest ecosystem is considered for his report because large number of organisms are present in forest ecosystem. Species diversity is greatest in the geographical location of tropics, particularly in tropical forests. Marine ecosystem is also considered for his report due to the presence of large number of different types of species particularly in coral reef which is a habitat of large number of organism.
What is the role of the nucleus in plant and animal cells?
O
A. It stores the genetic information for the cell.
B. It serves as a boundary for the cell.
o
C. It produces energy for the cell.
O
D. It stores waste for the cell.
Answer:
Explanation:
It’s A I’m pretty sure
7 Which answer best describes
condensation?
A A gas changing into a liquid
B A liquid changing into a solid
C A solid changing into a liquid
D A liquid changing into a gas