chenango industries uses 10 units of part jr63 each month in the production of radar equipment. the cost of manufacturing one unit of jr63 is the following:

Answers

Answer 1

The cost of manufacturing one unit of the jr63 is $24,000.

What is manufacturing?

Manufacturing refers to the process of transforming raw materials, components, or parts into finished goods that can be sold to customers. It involves a series of activities such as designing, prototyping, testing, producing, and distributing products. Manufacturing can be performed on a small or large scale, and can be done manually or with the use of machines and advanced technologies. The manufacturing industry includes a variety of sectors such as automotive, aerospace, electronics, pharmaceuticals, and food and beverage. It plays a crucial role in the economy of many countries by creating jobs, generating revenue, and contributing to technological advancements. Overall, manufacturing is a complex and dynamic process that requires careful planning, efficient management, and continuous innovation to stay competitive in the global market.

Unit cost of JR63= $76,000 - $52,000 = $24,000.

To learn more about manufacturing, visit:

https://brainly.com/question/13740503

#SPJ1

Complete Question:

Chenango Industries uses 10 units of part JR63 each month in the production of radar equipment. The cost of manufacturing one unit of JR63 is the following: points Direct material Material handling (20% of direct-material cost) Direct labor Manufacturing overhead (150€ of direct labor) Total manufacturing cost $ 5,000 1,000 28.000 42,000 $ 76,000 eBook Print Material handling represents the direct variable costs of the Receiving Department that are applied to direct materials and purchased components on the basis of their cost. This is a separate charge In addition to manufacturing overhead. Chenango Industries' annual manufacturing overhead budget is one-third variable and two-thirds fixed. Scott Supply, one of Chenango Industries' reliable vendors, has offered to supply part number JR63 at a unit price of $52,000. Required: References 1. If Chenango Industries purchases the JR63 units from Scott, the capacity Chenango Industries used to manufacture these parts would be idle. Should Chenango Industries decide to purchase the parts from Scott, the unit cost of JR63 would increase (or decrease) by what amount?


Related Questions

Bosses with psychopathic tendencies: appreciate followers who are active. are remorseless about the use of others. spend too much time promoting others. dread or fear giving feedback to followers. Which of the following is true of destructive bosses? They can cause social and psychological harm to their employees. They use rational persuasion to when trying to manage down. They spend too much time promoting others. They dread or fear giving feedback to followers.

Answers

They can cause social and psychological harm to their employees  is true of destructive bosses. The answer is OPTION A.  

Destructive managers occasionally mimic poor behavior they seen in previous jobs. They can be acting out problems in their own personal lives. People of color and LGBTQ+ individuals occasionally work for harmful supervisors who are driven by racism or homophobia. A toxic boss is a manager who undermines and harms the team members they supervise.

Employees' sense of belonging is diminished, their autonomy is taken away, and their sense of purpose is diminished as a result of their persistent disruptive behavior—all of which are essential for flourishing at work. Maintain your professionalism even if your employer is poisonous. Be courteous, truthful, and concise. The answer is OPTION A.  

To learn more about employees, click here.

https://brainly.com/question/21847040

#SPJ4

They can cause social and psychological harm to their employees  is true of destructive bosses. The answer is OPTION A.  

Destructive managers occasionally mimic poor behavior they seen in previous jobs. They can be acting out problems in their own personal lives. People of color and LGBTQ+ individuals occasionally work for harmful supervisors who are driven by racism or homophobia. A toxic boss is a manager who undermines and harms the team members they supervise.

Employees' sense of belonging is diminished, their autonomy is taken away, and their sense of purpose is diminished as a result of their persistent disruptive behavior—all of which are essential for flourishing at work. Maintain your professionalism even if your employer is poisonous. Be courteous, truthful, and concise. The answer is OPTION A.  

To learn more about employees, click here.

https://brainly.com/question/21847040

#SPJ4

Which of the following is true regarding assault? a. Assault is an intentional, nonconsensual act that gives rise to the apprehension that a harmful or offensive contact is imminent. offensive contact is imminent. harmful or offensive contact is imminent. b. Assault is an intentional, nonconsensual act that gives rise to the fear that a harmful or c. Assault is a negligent, nonconsensual act that gives rise to the apprehension that a harmful or offensive contact is imminent
d. Assault is a negligent, nonconsensual act that gives rise to the fear that a harmful or offensive contact is imminent.

Answers

The correct answer regarding assault is  Assault is an intentional, nonconsensual act that gives rise to the apprehension that a harmful or offensive contact is imminent. The correct option is a).

This means that the individual committing the assault intended to cause fear or apprehension in the victim that they will be harmed or subjected to an offensive act. This fear or apprehension can be caused through actions, words, or gestures that lead the victim to believe that they are in imminent danger of being harmed.

It's important to note that assault does not require physical contact to occur. It is enough for the victim to believe that they are in danger or fear that harm will come to them. Additionally, the harm or offense that is threatened does not have to be severe or significant. It only needs to be enough to cause the victim to feel fearful or apprehensive.

Assault is a serious offense and can have significant consequences. It is considered a criminal offense, and those found guilty of committing assault can face legal penalties, including imprisonment and fines. It is important to understand the definition of assault and how it differs from other types of criminal offenses, such as battery, which involves actual physical harm or contact.

By understanding the definition of assault, individuals can better protect themselves and recognize when they have been victimized by this type of crime. hence,  The correct option is a).

To learn more about Assault here:

https://brainly.com/question/30394164#

#SPJ11

vinny the ceo of rainholm industries is looking to employ a ________ strategy, which would take advantage of economies of scale and location economies. He wishes to pursue and establish a global division of labor based on wherever best-of-class capabilities reside at the lowest possible cost for Rainholm Industries.A) global standardization B) multidomestic C) international D) transnational

Answers

Vinny the CEO of Rainholm Industries is looking to employ a transnational strategy, which would take advantage of economies of scale and location economies. He wishes to pursue and establish a global division of labor based on wherever best-of-class capabilities reside at the lowest possible cost for Rainholm Industries.

This strategy involves balancing the benefits of global standardization with the need for local responsiveness and customization, making it the most suitable option for industries like Rainholm.

A transnational strategy seeks to achieve both global efficiency and local responsiveness by simultaneously leveraging economies of scale and location economies while adapting products and services to local markets. This involves establishing a network of operations and suppliers worldwide that can take advantage of different locations' capabilities and resources while maintaining global consistency in branding, technology, and standards.

In contrast, a global standardization strategy focuses on standardizing products and services globally to achieve economies of scale, while a multidomestic strategy involves customizing products and services to local markets to achieve local responsiveness. An international strategy involves exporting products and services to international markets with limited adaptation.

Learn more about economies here:

https://brainly.com/question/2421251

#SPJ11

The Brownian Motion is used to model the liquid assets (i.e. "cash") of our startup company Math Finance Inc. You are our company's CFO (Chief Financial Officer). The initial value of our assets is 5 (measured in tens of thousands of dollars). The drift and volatility for the first two years turns out to be 2 and 3 respectively. During the next two years, the drift and volatility was observed to be 3 and 4 respectively. What can you say about the probabilistic behavior of our assets at the end of year four? Give proper mathematic 2 al explanation. What is the probability that our assets will be worth at least $15,000?

Answers

In summary, the Brownian Motion model can help us understand the probabilistic behavior of our liquid assets over time, but we need more information (specifically, the values of Z) to provide a precise probability of our assets reaching a certain value.

As the CFO of Math Finance Inc., I can provide an analysis of the company's liquid assets using the Brownian Motion model. The Brownian Motion model can help predict the probabilistic behavior of assets over time, taking into account the drift and volatility.
For the first two years, our assets have an initial value of $50,000 (5 x 10,000), a drift of 2, and a volatility of 3. For the next two years, the drift and volatility change to 3 and 4 respectively.
To analyze the probabilistic behavior of our assets at the end of year four, we can use the following formula:
A(T) = A(0) * exp((drift - (volatility^2)/2) * T + volatility * sqrt(T) * Z)
where A(T) is the asset value at time T, A(0) is the initial asset value, drift and volatility are the respective values during the time period, T is the time period in years, and Z is a standard normal random variable.
Given the different drift and volatility values for the first and second two-year periods, we will need to apply the formula for each period separately and then combine the results.
Unfortunately, without knowing the values of Z for each period, it is impossible to provide a specific probability of our assets being worth at least $150,000 at the end of year four. However, this formula can be used to perform simulations and calculate the probability based on the assumed values of Z.

Learn more about probabilistic here:

https://brainly.com/question/30630304

#SPJ11

You have the following information for Crane Company. Crane uses the periodic method of accounting for its inventory transactions. Crane only carries one brand and size of diamonds-all are identical. Each batch of diamonds purchased is carefully coded and marked with its purchase cost. March 1 Beginning inventory 160 diamonds at a cost of $300 per diamond. March 3 Purchased 210 diamonds at a cost of $340 each. March 5 Sold 170 diamonds for $600 each. March 10 Purchased 325 diamonds at a cost of $365 each. March 25 Sold 380 diamonds for $650 each. (b) Assume that Crane uses the FIFO cost flow assumption. Calculate cost of goods sold: How much gross profit would the company report under this cost flow assumption? Cost of goods sold $ Gross profit $

Answers

Using the FIFO cost flow assumption, the cost of goods sold and gross profit for Crane Company can be calculated as follows:

1. Determine the cost of the ending inventory:

160 diamonds x $300 per diamond = $48,000 (from beginning inventory)

50 diamonds x $340 per diamond = $17,000 (from March 3 purchase)

320 diamonds x $365 per diamond = $116,800 (from March 10 purchase)

Total cost of ending inventory = $181,800

2. Determine the cost of goods sold:

170 diamonds x $300 per diamond = $51,000 (from beginning inventory)

10 diamonds x $340 per diamond = $3,400 (from March 3 purchase)

200 diamonds x $365 per diamond = $73,000 (from March 10 purchase)

Total cost of goods sold = $127,400

3. Determine the gross profit:

Revenue from sales = 170 diamonds x $600 per diamond + 380 diamonds x $650 per diamond = $365,000

Gross profit = Revenue from sales - Cost of goods sold = $365,000 - $127,400 = $237,600

Therefore, the cost of goods sold under the FIFO cost flow assumption is $127,400 and the gross profit is $237,600.

To know more about FIFO cost flow assumption -

https://brainly.com/question/24102676

#SPJ1

Which of the following is a capital expenditure?
Select one:
A. Cost to replace spark plug on company lawnmower
B. Cost to purchase garbage cans for the company conference room
C. Cost to have store windows washed
D. Cost to add air conditioning to a company car

Answers

D. Cost to add air conditioning to a company car is a capital expenditure as it is a cost that will provide a long-term benefit to the company and increase the value of the car.

What is capital expenditure?

A capital expenditure is a type of expenditure that is used to acquire, improve, or maintain a long-term asset, such as property, plant, or equipment, which is expected to provide a benefit to the business for more than one accounting period.

Out of the options given, the cost to add air conditioning to a company car would be considered a capital expenditure because it involves a long-term asset (the car) and is expected to provide a benefit to the business for more than one accounting period.

The cost to replace a spark plug on a company lawnmower, the cost to purchase garbage cans for the company conference room, and the cost to have store windows washed are all examples of operating expenditures, which are expenses incurred in the course of normal business operations and are expected to be consumed within a single accounting period.

To know more about capital expenditure, visit:

https://brainly.com/question/30050613

#SPJ1

Complete question is: Cost to add air conditioning to a company car is a capital expenditure.

Question 19 of 50 > When cloning a foreign DNA fragment into a plasmid, it is often useful to insert the fragment at a site that interrupts a selectable marker (such as the tetracycline-resistance gene of PBR322). The loss of function of the interrupted gene can be used to identify clones containing recombinant plasmids with foreign DNA. With a yeast artificial chromosome (YAC) vector, a researcher can distinguish vectors that incorporate large foreign DNA fragments from those that do not, without interrupting gene function. How are the recombinant vectors in a YAC typically identified? The YAC vector contains a gene that confers antibiotic resistance: vectors containing foreign DNA will grow on a plate containing this antibiotic. The gene encoding P-galactosidase becomes inactive due to insertion of foreign DNA, so colonies grown on an ngar plate containing X-gal appear white instead of blue, The YAC vector contains a screenable marker that encodes for a protein that causes the cell to produce an easily identifiable fluorescent molecule. The two parts of a YAC vector contain two selectable markers that are not interrupted by the foreign DNA, and both must be present for the cell to survive on the selective medias Which of these is not a risk associated with GMO foods? Heavy government regulation will drive up the price of modified food crops for consumers. O Loss of genetic diversity in crops may make them more vulnerable to discase. Pests that we want to kill may becomeresistant to insect-killing Bt crystals in modified crops. Organisms that are not considered pests may inadvertently be killed by insect-resistant, genetically modified crops. There may be unknown costs that offset the apparent financial advantages of raising modified crops.

Answers

Okay, here are the answers:

19. The YAC vector contains a screenable marker that encodes for a protein that causes the cell to produce an easily identifiable fluorescent molecule.

Risks associated with GMO foods (question 20 options):

O  Loss of genetic diversity in crops may make them more vulnerable to discase.

Pests that we want to kill may becomeresistant to insect-killing Bt crystals in modified crops.

X  Organisms that are not considered pests may inadvertently be killed by insect-resistant, genetically modified crops.

There may be unknown costs that offset the apparent financial advantages of raising modified crops.

The option "Heavy government regulation will drive up the price of modified food crops for consumers." is not a risk associated with GMO foods.

Government regulation adding cost is an economic argument, whereas the other options discuss environmental or ecological risks from GMO foods.

Let me know if you have any other questions!

Which type of managers of a business must answer to a board of directors regarding the company's fiscal performance

Answers

Answer: The CEO (Chief Executive Officer) and the CFO (Chief Financial Officer) are the managers who would answer to a board of directors regarding the company's fiscal performance.

The CEO is responsible for the overall management of the company and the achievement of its goals, while the CFO is responsible for the financial management of the company, including financial reporting, budgeting, and forecasting.

Both of these managers have a critical role in ensuring that the company is meeting its financial objectives and reporting accurate and timely financial information to the board of directors.

Other senior managers, such as the COO (Chief Operating Officer) and the CMO (Chief Marketing Officer), may also provide input to the board on their respective areas of responsibility, but the CEO and CFO are typically the primary managers responsible for financial performance.

in 15 years, we want to take a cruise to london. we estimate the cost will be $45,000. how much do we need to invest today if we earn: 4ompounded semi annually

Answers

They need to invest $24,848.15 today to make their cruise to London after 15 years with the 4% compounded semi annually rate.

If you invest today at a 4% compounded semi-annually rate, you must compute the present value of the $45,000 you want to spend in 15 years using the same present value calculation but altering the interest rate and period:

Present value = Future value / (1 + (interest rate / number of compounding periods)) ^ (time x number of compounding periods)

When the future value is $45,000, the interest rate is 4%, the time period is 15 years, and the number of compounding periods each year is two (semi-annually).

Present value = 45,000 / (1 + (0.04 / 2))⁽³⁰⁾

Present value = $24,848.15

So, to have $45,000 in 15 years, you would need to invest $24,848.15 now at a rate of 4% compounded semi-annually.

Learn more about Compound Interest Rate:

https://brainly.com/question/28020457

#SPJ4

Complete Question:

In 15 years, we want to take a cruise to London. We estimate the cost will be $45,000. How much do we need to invest today if we earn:

A. 4%

B. 4% compounded semi annually

They need to invest $24,848.15 today to make their cruise to London after 15 years with the 4% compounded semi annually rate.

If you invest today at a 4% compounded semi-annually rate, you must compute the present value of the $45,000 you want to spend in 15 years using the same present value calculation but altering the interest rate and period:

Present value = Future value / (1 + (interest rate / number of compounding periods)) ^ (time x number of compounding periods)

When the future value is $45,000, the interest rate is 4%, the time period is 15 years, and the number of compounding periods each year is two (semi-annually).

Present value = 45,000 / (1 + (0.04 / 2))⁽³⁰⁾

Present value = $24,848.15

So, to have $45,000 in 15 years, you would need to invest $24,848.15 now at a rate of 4% compounded semi-annually.

Learn more about Compound Interest Rate:

https://brainly.com/question/28020457

#SPJ4

Complete Question:

In 15 years, we want to take a cruise to London. We estimate the cost will be $45,000. How much do we need to invest today if we earn:

A. 4%

B. 4% compounded semi annually

In a certain large city there are two firms that supply concrete. The concrete sold by the first firm is indistinguishable from the concrete sold by the second firm. Is the market competitive?

Answers

Yes, the market for concrete in this large city is competitive because there are two firms supplying the same product and the concrete sold by both firms is indistinguishable, meaning consumers have the option to choose between the two firms based on price or other factors.

This competition encourages both firms to offer competitive prices and quality to attract customers. A market is considered competitive when there are multiple buyers and sellers operating in the market, with no single entity having control over the market price or supply. In a competitive market, buyers and sellers have access to perfect information, which means they can easily obtain information about prices, quantities, and quality of goods and services.

In contrast, a market that is dominated by a single seller or a small group of sellers with significant market power is considered to be less competitive. In such a market, the seller(s) have the ability to influence the market price and supply, potentially leading to higher prices and reduced output. Therefore it is correct.

Learn more about market competitive https://brainly.com/question/28267513

#SPJ11

Debt securities that are accounted for at amortized cost, not fair value, areA. never-sell debt securities.B. held-to-maturity debt securities.C. trading debt securities.D. available-for-sale debt securities.

Answers

The correct answer is B. held-to-maturity debt securities. These are debt securities that the company has the intent and ability to hold until maturity and are therefore accounted for at amortized cost.

Trading and available-for-sale debt securities are accounted for at fair value, while never-sell debt securities is not a recognized accounting term.
Debt securities that are accounted for at amortized cost, not fair value, are B. held-to-maturity debt securities.
Held-to-maturity debt securities are financial instruments that an entity intends to hold until they reach their maturity date. These securities are accounted for at amortized cost rather than fair value because the entity plans to keep them until they fully mature, and their value is recognized gradually over time.

Learn more about securities here:

https://brainly.com/question/28070333

#SPJ11

the u.s. experienced _______recessions between the years 1944 and 2018 with an average duration of _______ months

Answers

The U.S. experienced 11 recessions between the years 1944 and 2018 with an average duration of 11 months.

The United States has experienced a number of recessions throughout its history, with varying durations and severity. Between the years 1944 and 2018, there were a total of 11 recessions. The average duration of these recessions was approximately 11 months, with some being much shorter and others lasting several years.

Recessions are generally defined as periods of significant economic decline, typically marked by a decrease in the gross domestic product (GDP) for two consecutive quarters. They can be caused by a variety of factors, including changes in consumer and business spending, fluctuations in interest rates, and shifts in global trade patterns.

To learn more recessions, visit here

https://brainly.com/question/18075358

#SPJ4

A family has a net worth of $155,000 and liabilities of $167,000. What is the amount of their assets?
A. $167,000
B. $155,000
C. $12,000
D. $322,000
E. –$12,000

Answers

The net worth of a family is the difference between their assets and liabilities. To find the amount of their assets, we need to add their net worth ($155,000) to their liabilities ($167,000). This gives us a total of $322,000 in assets (option D).

It's important to note that the family's net worth being lower than their liabilities (which results in a negative net worth) would mean they owe more than they own and their assets would be less than $155,000. However, that is not the case in this scenario.

Total liabilities are all of a business's responsibilities and debts to third parties. All of the company's assets are included as assets, and all sums owed for upcoming obligations are recorded as liabilities.

For more such questions on liabilities , click on:

https://brainly.com/question/29658251

#SPJ11

Under the Labor Theory of Value, the profits, i.e. the returns for all inputs earned by a company should be distributed to: a. The Bank or other Lending Entity that provided the Capital b. The Workers at the Company c. Equally between Labor and Shareholders d. The Owners of the Company

Answers

The distribution of profits between labor and shareholders would depend on the specific circumstances of the company and its ownership structure, but under the Labor Theory of Value, the workers should receive a significant portion of the profits.

According to the Labor Theory of Value, the profits earned by a company should be distributed to the workers at the company. This theory suggests that the value of a good or service is based on the amount of labor that went into producing it, rather than the amount of capital invested. Therefore, the workers who provided the labor should receive a fair share of the profits. The bank or other lending entity that provided the capital would not be entitled to a share under this theory, as their contribution was not based on labor. The distribution of profits between labor and shareholders would depend on the specific circumstances of the company and its ownership structure, but under the Labor Theory of Value, the workers should receive a significant portion of the profits.

Learn more about ownership structure here

https://brainly.com/question/30194713

#SPJ11

Airbnb, Inc. The following questions are based on both favorable and unfavorable descriptive evidence of issues faced by Airbnb, as well as the underlying influences that affect the firm as they are observed in the case. In addition, you will find a general question on solutions that can be answered from information detailed in the case Multiple choice versions of evidence and influences are presented first (Descriptive Evidence 1 and Underlying influences 1). Short-answer questions, which will be manually graded by your professor, are presented second (Descriptive Evidence 2 and Underlying Influences 2). Each question under Evidence corresponds to the same question under Influences (eg. A Question 3 under Descriptive Evidence 1 corresponds to Question 3 under Underlying Influences 1), The goal of this exercise is to help you reflect and analyze the case material outside of class. Answering the following questions will enhance your understanding of some of the key issues of the case, as well as your participation in class discussions related to it Read the complete case on Airbnb and then answer the questions that followUnderlying Influences 1 What aspect of the PESTEL framework had an impact on Airbnb's attractiveness to investors in 2010?A. global financial crisis B. popularity of Uber C. decline of sharing economy D. laws against short-term rentals E. economic boom

Answers

E. Economic boom had an impact on Airbnb's attractiveness to investors in 2010.

What is an Economic boom?

An economic boom is a period of rapid and sustained economic growth, typically characterized by increased business activity, rising employment rates, and high levels of consumer confidence and spending. During an economic boom, the overall economy is expanding and generating wealth at a faster rate than usual, which can lead to increased investment, higher stock prices, and rising real estate values. Economic booms are often fueled by factors such as low interest rates, government spending, technological innovation, and high levels of business and consumer confidence. However, economic booms can also be followed by periods of economic contraction, or downturns, as the economy adjusts to changing conditions.

The PESTEL framework:

The PESTEL framework is a tool used to analyze the macro-environmental factors that can impact a company's business operations and profitability. The acronym stands for Political, Economic, Sociocultural, Technological, Environmental, and Legal factors.

In this case, the aspect of the PESTEL framework that had an impact on Airbnb's attractiveness to investors in 2010 was the economic factor, specifically the economic boom. At the time, the global economy was experiencing a period of growth and expansion, which meant that investors were looking for promising opportunities to invest their money. Airbnb's innovative business model, which offered an alternative to traditional hotel accommodations, was seen as a promising and potentially profitable venture, which made it attractive to investors. As a result, the company was able to secure significant investment funding during this time, which helped it grow and expand rapidly.

To know more about Economic boom, visit:

https://brainly.com/question/15850481

#SPJ1

use the values in the range b12:c12 to extend the incremented percentage to the range d12:h12

Answers

Using the values in B12:C12, extend the incremented percentage to D12:H12 by calculating the percentage increment, applying it to C12, and filling in D12:H12.

To use the values in the range B12:C12 to extend the incremented percentage to the range D12:H12, follow these steps:

1. Calculate the percentage increment between B12 and C12 by using the formula: (C12-B12)/B12.
2. Apply the calculated percentage increment to C12 and fill it in D12 with the formula: C12 * (1 + percentage increment).
3. Copy the formula in D12 and paste it into E12:H12.


Determine the percentage increment between B12 and C12, then apply this increment to C12 to get D12. Copy the formula from D12 to E12:H12 to fill the rest of the range. This will ensure the same percentage increment is applied across the entire D12:H12 range.

To know more about  percentage increment click on below link:

https://brainly.com/question/24490227#

#SPJ11

What must you do this before you can edit the Member's MGIB election?

Answers

Before you can edit a Member's MGIB (Montgomery GI Bill) election, you must first ensure that the Member has a valid and active MGIB entitlement on file with the VA (Veterans Affairs).

And that the Member has completed the necessary paperwork and processes to elect to use their MGIB benefits. It is also important to verify that the Member meets all eligibility requirements for the MGIB program. Once these steps have been completed, you can then proceed to edit the Member's MGIB election as needed.

To edit a member's MGIB (Montgomery GI Bill) election, you must first obtain the necessary authorization from the member, ensuring that they have provided consent to make changes to their benefits. This step is crucial for maintaining accurate records and adhering to privacy regulations.

Visit here to learn more about privacy regulations brainly.com/question/30509900

#SPJ11

how is life insurance pricing a binomial problem

Answers

Life insurance pricing can be seen as a binomial problem because it involves two possible outcomes (success and failure) and requires actuaries to calculate the probabilities and potential payouts associated with each outcome to determine the appropriate premium to charge.

A binomial problem is one that involves two possible outcomes, often referred to as "success" and "failure." In the context of life insurance pricing, these two outcomes can be defined as follows:

1. Success: The policyholder remains alive during the coverage period and the insurer does not have to pay out a death benefit.
2. Failure: The policyholder dies during the coverage period and the insurer has to pay out a death benefit.

When pricing life insurance, actuaries use historical data, mortality tables, and other factors to calculate the probability of each outcome occurring for a specific policyholder. They then determine the appropriate premium to charge based on these probabilities, ensuring that the insurer can cover the potential payouts while still making a profit.

The steps for considering life insurance pricing as a binomial problem are as follows:

1. Determine the probabilities of success (policyholder surviving) and failure (policyholder dying) using relevant data and factors such as age, gender, health status, and lifestyle.
2. Calculate the potential payout for each outcome (no payout for success, death benefit for failure).
3. Use these probabilities and potential payouts to determine the appropriate premium to charge for the policy.

For more such questions on Life insurance

brainly.com/question/1373572

#SPJ11

A company's holding cost is 16% per year. Its annual inventory turns are 10. The company buys an item for $40. Round your answer to 2 decimal places.) What is the average cost (in $s) to hold each unit of this item in inventory?

Answers

The average cost to hold each unit of this item in inventory is $0.64.

To calculate the average cost to hold each unit of this item in inventory, we need to consider the company's holding cost, annual inventory turns, and the item's cost.

In order to calculate the average cost to hold, follow these steps:

1. Determine the holding cost per unit per year:

16% of the item's cost ($40) = 0.16 * $40 = $6.4

2. Determine the number of days in a year for inventory turns:

365 days / 10 turns = 36.5 days per turn

3. Calculate the holding cost per unit for one turn:

($6.4 holding cost per year) * (36.5 days per turn / 365 days) = $6.4 * 0.1 = $0.64

Hence, the average cost to hold each unit of this item in inventory is $0.64.

Learn more about Holding cost:

https://brainly.com/question/16524296

#SPJ11

Using the information in Exhibit 16-2, the natural rate of unemployment is approximately
(a) 2.8 percent.
(b) 10.3 percent.
(c) 11.7 percent.
(d) 21.5 percent.

Answers

Using the information in Exhibit 16-2, the natural rate of unemployment is approximately (a) 2.8 percent.

Exhibit 16-2 likely contains data related to the labor market, such as unemployment rates, employment levels, or other relevant indicators. Based on the information provided, it is suggested that the natural rate of unemployment is approximately 2.8 percent.

The natural rate of unemployment refers to the level of unemployment that is considered to be consistent with the underlying structure of an economy, where there is neither a cyclical nor a structural imbalance in the labor market.

It represents the rate of unemployment that would prevail when an economy is operating at its potential output, with all available resources being fully utilized.

A natural rate of unemployment around 2.8 percent would indicate that the economy is operating close to its full employment level, with only a small portion of the labor force being unemployed due to factors such as frictional or seasonal unemployment.

Frictional unemployment refers to the temporary unemployment that occurs as workers transition between jobs, while seasonal unemployment is associated with changes in labor demand due to seasonal variations in economic activity.

It's important to note that the natural rate of unemployment can vary over time and across countries or regions, depending on various factors such as labor market conditions, demographic changes, technological advancements, and government policies.

Economic policymakers often monitor and analyze labor market data, such as the unemployment rate, to assess the health of the labor market and make informed decisions about monetary or fiscal policies.

It's also worth mentioning that calculating the natural rate of unemployment is a complex task that requires careful analysis and consideration of multiple factors.

Different economic models and methodologies can be used to estimate the natural rate of unemployment, and it can be subject to revisions as new data becomes available.

Therefore, it's important to rely on reliable and up-to-date data sources and consult with expert analysis to accurately estimate the natural rate of unemployment.

To learn more about unemployment, refer below:

https://brainly.com/question/14227610

#SPJ11

Using the information in Exhibit 16-2, the natural rate of unemployment is approximately (a) 2.8 percent.

Exhibit 16-2 likely contains data related to the labor market, such as unemployment rates, employment levels, or other relevant indicators. Based on the information provided, it is suggested that the natural rate of unemployment is approximately 2.8 percent.

The natural rate of unemployment refers to the level of unemployment that is considered to be consistent with the underlying structure of an economy, where there is neither a cyclical nor a structural imbalance in the labor market.

It represents the rate of unemployment that would prevail when an economy is operating at its potential output, with all available resources being fully utilized.

A natural rate of unemployment around 2.8 percent would indicate that the economy is operating close to its full employment level, with only a small portion of the labor force being unemployed due to factors such as frictional or seasonal unemployment.

Frictional unemployment refers to the temporary unemployment that occurs as workers transition between jobs, while seasonal unemployment is associated with changes in labor demand due to seasonal variations in economic activity.

It's important to note that the natural rate of unemployment can vary over time and across countries or regions, depending on various factors such as labor market conditions, demographic changes, technological advancements, and government policies.

Economic policymakers often monitor and analyze labor market data, such as the unemployment rate, to assess the health of the labor market and make informed decisions about monetary or fiscal policies.

It's also worth mentioning that calculating the natural rate of unemployment is a complex task that requires careful analysis and consideration of multiple factors.

Different economic models and methodologies can be used to estimate the natural rate of unemployment, and it can be subject to revisions as new data becomes available.

Therefore, it's important to rely on reliable and up-to-date data sources and consult with expert analysis to accurately estimate the natural rate of unemployment.

To learn more about unemployment, refer below:

https://brainly.com/question/14227610

#SPJ11

In MRP processing the difference between a planned-order release and the planned-order receipt is: O level of safety stock. ( scheduled receipts of open orders. ( a one is a forecast and the other is actual. O timing as per the lead time. o the level of net requirements.

Answers

In MRP processing, the difference between a planned-order release and a planned-order receipt is primarily based on timing as per the lead time. A planned-order release is when an order is created and released to the system to be executed at a specific time in the future.

This is done to ensure that materials are available for production in a timely manner. On the other hand, a planned-order receipt is when the order is actually received and processed by the system. This occurs when the materials are physically received and checked against the order.

Additionally, the level of net requirements and the scheduled receipts of open orders also play a role in determining the difference between a planned-order release and a planned-order receipt. The level of safety stock is taken into account to ensure that there is always enough inventory on hand to cover unexpected changes in demand or supply.

Learn more about planned-order https://brainly.com/question/29770143

#SPJ11

Countries with demanding consumers, like environmentally-concerned Denmark, drive ________ to meet the demand. A) worldwide innovation B) in-country innovation C) foreign manufacturing D) global exchange

Answers

Countries with demanding consumers, like environmentally-concerned Denmark, drive innovation to meet the demand. The answer is A) worldwide innovation.

Countries with demanding consumers, like environmentally-concerned Denmark, drive to meet the demand.
The correct answer is: Countries with demanding consumers, like environmentally-concerned Denmark, drive worldwide innovation to meet the demand. The answer is A) worldwide innovation. Demanding consumers push for innovation to meet their needs, and this in turn drives worldwide innovation as companies strive to meet those demands.

Learn more about innovation here:

https://brainly.com/question/30929075

#SPJ11

Supply Chain Management performs three main business processes:1. Materials flow from supplies and their upstream suppliers at all levels.2. Materials are transformed into semi-finished and finished products - the organization's own production processes.3. Products are distributed to customers and their downstream customers at all levels

Answers

Based on your question, it seems like you want to know how the terms "materials" and "customers" fit into the three main business processes of Supply Chain Management.


1. Materials flow from supplies and their upstream suppliers at all levels: This process refers to the procurement of raw materials and supplies from various sources, including upstream suppliers. These materials are then transported to the organization's production facilities where they are used to manufacture products. The goal of this process is to ensure that the organization has access to the materials it needs to produce its products.

2. Materials are transformed into semi-finished and finished products - the organization's own production processes: This process involves the transformation of raw materials into semi-finished and finished products through the organization's production processes. This may involve various stages of production, such as assembly, manufacturing, and packaging. The goal of this process is to produce high-quality products that meet the needs of customers.

3. Products are distributed to customers and their downstream customers at all levels: This process involves the distribution of finished products to customers and their downstream customers at all levels. This may involve transportation, storage, and delivery of products to various locations. The goal of this process is to ensure that customers receive their orders in a timely and efficient manner.

.

Learn more about Management here:

https://brainly.com/question/29023210

#SPJ11

Supply Chain Management performs three main business processes:

1. Materials flow from supplies and their upstream suppliers at all levels.

2. Materials are transformed into semi-finished and finished products - the organization's own production processes.

3. Products are distributed to customers and their downstream customers at all levels.

According to Jonah, an hour saved at a non-bottleneck is Select one or more:a. something he strives to do when consulting.b. a mirage.c. difficult to accomplishd. a big deal.

Answers

According to Jonah, an hour saved at a non-bottleneck is a mirage. Option B is answer.

This is because non-bottlenecks have excess capacity, which means that they can produce more than is needed. Saving time at a non-bottleneck does not increase the overall output of the system, as the bottleneck will still limit the total output. In fact, focusing on non-bottlenecks can actually lead to an increase in inventory and other inefficiencies. Jonah advocates focusing on optimizing the bottleneck to increase overall system throughput and efficiency.

Option B is answer.

You can learn more about mirage at

https://brainly.com/question/29910648

#SPJ11

Alisa has started a program to enrich the jobs of the members of her staff by adding a greater variety of tasks to each job. She is using the technique of job enlargement. a. True b. False

Answers

The answer to the question is true. Alisa has implemented job enlargement as a technique to enrich the jobs of her staff by adding more diverse tasks to each role.

Job enlargement is a type of job design that involves adding more tasks and responsibilities to an employee's job to make it more challenging and rewarding. This technique aims to provide employees with a more diverse range of tasks to complete and to increase their skill set. By implementing job enlargement, Alisa hopes to motivate her staff by providing them with a wider range of duties, allowing them to develop new skills and experience, and promoting personal growth. This, in turn, is likely to increase job satisfaction and reduce staff turnover. Overall, job enlargement is an effective way to enhance employee engagement and improve organizational performance.

To know more about employees refer to

https://brainly.com/question/27404382

#SPJ11

price clancy’s quantity demanded eileen’s quantity demanded (dollars per slice) (slices) (slices) 1 40 80 2 30 60 3 20 40 4 10 20 5 0 10

Answers

Based on the information provided, the table shows the relationship between the price of a slice of pizza and the quantity demanded by two individuals, Price Clancy and Eileen. At a price of $1 per slice, Price Clancy demands 40 slices and Eileen demands 80 slices.

As the price of a slice decreases, the quantity demanded by both individuals increases. This is known as the law of demand, which states that as the price of a good or service decreases, the quantity demanded will increase, all else equal. At a price of $5 per slice, Price Clancy demands 0 slices and Eileen demands 10 slices.

This suggests that at higher prices, the quantity demanded for pizza decreases, as consumers may choose to substitute pizza with other food options or reduce their overall consumption. It is important to note that the table only shows the relationship between price and quantity demanded, and does not take into account other factors that may impact demand, such as consumer preferences, income levels, and availability of substitutes.

Learn more about quantity  here:

https://brainly.com/question/12986460

#SPJ11

3. Individual and market demand

Suppose that Clancy and Eileen are the only consumers of pizza slices in a particular market. The following table shows their annual demand

schedules:

Price        Clancy's Quantity Demanded      Eileen's Quantity Demanded

(Dollars per slice         (Slices)                               (Slices)

1                                      40                                        80

2                                     30                                       60

3                                     20                                        40

4                                     10                                         20

5                                      0                                           10

On the following graph, plot Clancy's demand for pizza slices using the green points (triangle symbol). Next, plot Eileen's demand for pizza slices using the purple points (diamond symbol). Finally, plot the market demand for pizza slices using the blue points (circle symbol).

When a new product is very popular and the original firm is unable to keep up with consumer demand, other firms jump in to take advantage, a stage often called Select one a the maturity stageb. retrenchment. o c the shake out d. the boom

Answers

The stage often called when a new product is very popular and the original firm is unable to keep up with consumer demand, and other firms jump in to take advantage, is the boom stage. The correct option is D

During this stage, there is a high demand for the product, and new firms enter the market to capitalize on the opportunity.

However, as the market becomes saturated, there may be a shakeout where weaker firms are forced out of the market.

This stage is not to be confused with the maturity stage, which occurs when the product has been on the market for some time, and the growth rate slows down.

Retrenchment, on the other hand, refers to a strategic effort by a firm to cut back on its operations and expenses in order to improve its financial position.


To know more about boom stage refer here:

https://brainly.com/question/29875762#
#SPJ11

What do these results mean when evaluating Aim's Companies' profitability? (Assume the following industry averages: EPS = $0.25, pricelearnings ratio = 9.3.) Aim's Companies' price /earnings ratio for 2018 means that the company's stock is selling at ______ This is ___ price.earnings ratio would possibly ____

Answers

When evaluating Aim's Companies' profitability, the company's stock price and the price-to-earnings (P/E) ratio are key factors to consider.

The industry averages for Earnings Per Share (EPS) is $0.25 and the average price-to-earnings ratio is 9.3. Aim's Companies' P/E ratio for 2018 indicates how much investors are willing to pay for each dollar of generated by the company. If the P/E ratio is higher than the industry average of 9.3, this suggests that the company's stock is selling at a premium compared to its peers. If the P/E ratio is lower than 9.3, it implies that the stock is selling at a discount, and the price-to-earnings ratio would possibly make the stock more attractive to investors seeking value. To make profits from their commercial activities, companies must be profitable. Both investors and management value profitability as a vital indicator of a company's financial health. Several financial indicators, including gross profit margin, net profit margin, return on assets (ROA), and return on equity (ROE), may be used to assess a company's profitability.

Learn more about Companies' profitability here:

https://brainly.com/question/28174141

#SPJ11

You are given the following information for Golden Fleece Financial:- Long-term debt outstanding: $300,000- Current yield to maturity (r debt): 8%- Number of shares of common stock: 1 0,000- Price per share: $50 Book value per share: $25- Expected rate of return on stock (r equity): 1 5%Calculate Golden Fleece's company cost of capital. Ignore taxes.

Answers

The company cost of capital for Golden Fleece Financial is 12.5%.

The company cost of capital represents the weighted average cost of all the sources of funding used by the firm. In this case, the sources of funding are long-term debt and common equity. To calculate the company cost of capital, we use the formula:

Company cost of capital = (weight of debt x cost of debt) + (weight of equity x cost of equity)

Given the information, we can calculate the weights of debt and equity as follows:

Weight of debt = Long-term debt outstanding / (Long-term debt outstanding + market value of equity) = 300,000 / (300,000 + 500,000) = 0.375

Weight of equity = Market value of equity / (Long-term debt outstanding + market value of equity) = 500,000 / (300,000 + 500,000) = 0.625

Using the given information, the cost of debt is 8%, and the cost of equity is 15%. Substituting these values and the weights into the formula, we get:

Company cost of capital = (0.375 x 0.08) + (0.625 x 0.15) = 0.03 + 0.09375 = 0.12375 or 12.5%

Therefore, Golden Fleece Financial's company cost of capital is 12.5%.

For more questions like Cost click the link below:

https://brainly.com/question/30045916

#SPJ11

The following information is from the Income Statement of the Marigold Laundry Service: $6890 Revenues Service Revenues Expenses Salaries and wages expense $ 2600 Advertising expense 530 Rent expense 320 Supplies expense 210 Insurance expense Total expenses Net income 110 3770 $3120 The entry to close the Laundry Service Revenue account includes a: debit to Service Revenue for $6890. O credit to Service Revenue for $6890. Odebit to Income Summary for $6890. O debit to Retained Earnings for $6890.

Answers

The entry to close the Laundry Service Revenue account includes credit to Service Revenue for $6890. The correct option is B.

To move their amounts to the Retained Earnings account upon closing, revenue accounts are closed. The balance of the Service Revenue account is closed by transferring the funds to the Retained Earnings account because it is a revenue account. The balance of the Service Revenue account, in this case, $6890, must be credited in order to end it.

An organization's money from selling its products and services to clients is recorded in an account called service revenue. It appears on the income statement alongside other forms of income and expenses for the company. According to the accrual foundation of accounting, service revenue is recorded.

Thus, the ideal selection is option B.

Learn more about service revenue here:

https://brainly.com/question/31587002

#SPJ12

Other Questions
In the first stage of photosynthesis, light energy is converted into chemical energy and reducing equivalents (NADPH + H+). This phenomenon is called A) energy transduction B) decay c) radiation D) kinetic energy E) potential energy 16.5 ft tall giraffe casts a 12-ft. shadow. at the same time a zookeeper casts a 4-ft shadow how tall in feet is the zookeeper how many grams of na2co3 (fm 105.99) should be mixed with 5.00 g of nahco3 (fm 84.01) to produce 100 ml of buffer with ph 10.00? After plotting the voltage waveform, obtain a 0.2-mp expressions and generate plots for (t), p (t), and w (t) for i by capacitor. The voltage waveforms are given:(a) v_1(t) = 5r(t) - 5r(t 2) V (b) v_2(t) = 10u(-t) + 10u(t) - 5r(t-2) + 5r(t-4) V (c) v_3(t) = 15u(-t) + 15e^(-0.5t) u(t) V (d) v_4(t) = 150[1 - e^(-0.5t)] u(t) V angles of a triangle Are dichotomous keys purely a human invention? Explain. in galatians, paul uses ___________ as an example of one justified by faith. It is recommended to interview the HIS users to identify vital information to daily operation in contingency planning True False Which network topology is the most reliable and why?OA. Ring topology, because data flows in one direction from node tonode around the ringB. Star topology, because the server manages all network traffic inone location, making it convenientC. Bus topology, because on large networks it is easy to fix if a cablefails and all nodes lose connectionD. Fully connected mesh topology, because it provides a connectionfrom each node to every other node in the network A rule that CANNOT be violated by database users is called a:(A) password.(B) program.(C) constraint.(D) view. Which of the following variables of an asteroid collision affects the impact crater they leave behind?O SizeO SpeedO MassO All of the above 1. You want to clone a human DNA sequence into a plasmid. This DNA fragment was cut out of the human genome with restriction enzyme Sunl, whose restriction site is shown in the figure below. Sunl restriction site CGTACG GCATGC Plasmid cloning region AGGATCCCGAGTGTACACGTGGTACCAGAATTCCTTGGTACCTTTAAAACA TCCTAGGGCTCACATGTGCACCATGGTCTTAAGGAACCATGGAAATTTTGT BamHI Kpl EcoRI Asp7181 Dral Aau This figure also shows the multiple cloning region of your plasmid, with the potential restriction sites marked. A. Which of these restriction enzymes could be used to cleave the plasmid for successful insertion of this human DNA fragment? Note that there could be more than one correct answer B. Briefly explain how you would go about cloning the fragment into the plasmid. C. You successfully clone the human DNA into the plasmid, and store it in the freezer. Several months later, your advisor asks you to use this recombinant plasmid to prepare a large quantity of the human insert sequence with as little plasmid sequence as possible. Can you do this with restriction enzymes? What enzymes would you choose? Question 1. You want to clone a human DNA sequence into a plasmid. This DNA fragment was cut out of the human genome with restriction enzyme Sunl, whose restriction site is shown in the figure below. Sunl restriction site CGTACG GCATGC Plasmid cloning region AGGATCCCGAGTGTACACGTGGTACCAGAATTCCTTGGTACCTTTAAAACA TCCTAGGGCTCACATGTGCACCATGGTCTTAAGGAACCATGGAAATTTTGT BamHI Kpl EcoRI Asp7181 Dral Aau This figure also shows the multiple cloning region of your plasmid, with the potential restriction sites marked. A. Which of these restriction enzymes could be used to cleave the plasmid for successful insertion of this human DNA fragment? Note that there could be more than one correct answer B. Briefly explain how you would go about cloning the fragment into the plasmid. C. You successfully clone the human DNA into the plasmid, and store it in the freezer. Several months later, your advisor asks you to use this recombinant plasmid to prepare a large quantity of the human insert sequence with as little plasmid sequence as possible. Can you do this with restriction enzymes? What enzymes would you choose? You are spinning two identical balls attached to strings in uniform circular motion, Ball 2 has a string that is twice as long as the string with ball 1, and the rotational speed (v) of ball 2 is three times the rotational speed of ball 1. What is the ratio of the centripetal force of ball 2 to that of ball 1? Select all of the ratios that are equivalent to 1:5. What starting alkyl halide and ketone would give 2-methyl-2-pentanol? Write a grignard synthesis for this reaction. Please help!!!There is a photo! Pleasee help!! to the principal for remission of fine What are the bond angles? You want to buy a house within 3 years, and you are currently saving for the down payment.You plan to save $5000 at the end of the first year, and you anticipate that your annual savingswill increase by 10 % annually thereafter. Your expected annual return is 7%. How much wouldyou have for a down payment at the end of year 3? how do the values of the integral 1 2 q/t compare for a reversible and irreversible process between the same end states?