Answer:
Human blood is red because of the protein hemoglobin, which contains a red-colored compound called heme that's crucial for carrying oxygen through your bloodstream.
Blood gets its bright red color when hemoglobin picks up oxygen in the lungs
the oxygen essentally makes it red
Explanation:
Advantages of using tidal power include O no alr pollution
Otides are predictable
O low environmental Impact
O all of these
Answer:
all of these :)
Explanation:
i think
Answer:
Yes The Correct answer is ( All Of These)
explanation:
(GIVING BRAINLIEST!!)
Which common characteristic of planets do Saturn and Earth share?
A) They have rings.
B) They have moons.
C) They are made of rock.
D) They have thick atmospheres.
Answer:
THEY HAVE MOOOONNNNSSSSS
Explanation:
Please help I'm behind
Answer:
B : Barometer
Explanation:
A barometer is a scientific instrument used to measure atmospheric pressure, also called barometric pressure. The atmosphere is the layers of air wrapped around the Earth. That air has a weight and presses against everything it touches as gravity pulls it to Earth. Barometers measure this pressure.
construct a flowchart (using “->”) (or explain) that depicts all the energy transfers that occur from the sun to the milk of your cereal
Answer:
dragon warrior or whatever it is called I don't maybe I am right
Match each underlined word to its correct meaning based on the context of the sentence. Tom had long been picking his way cautiously through this treacherous forest; stepping from tuft to tuft of rushes and roots, which afforded precarious footholds among deep sloughs. It was a dreary memento of the fierce struggle that had taken place in this last foothold of the Indian warriors. He was sulky, however, and would not come to terms: she was to go again with a propitiatory offering, but what it was she forbore to say. At this propitious time of public distress did Tom Walker set up as a usurer in Boston.
Answer:
A. Tom had long been picking his way cautiously through this treacherous forest; stepping from tuft to tuft of rushes and roots, which afforded precarious footholds among deep sloughs. - 3.dangerous.
B. It was a dreary memento of the fierce struggle that had taken place in this last foothold of the Indian warriors. - 4.bleak.
C. He was sulky, however, and would not come to terms: she was to go again with a propitiatory offering, but what it was she forbore to say. - 2.conciliatory.
D. At this propitious time of public distress did Tom Walker set up as a usurer in Boston. - 1.favorable .
Explanation:
The given underlined words in each sentence are-
1. "Precarious" refers to something unstable, unconfirmed, dangerous, uncertain, unreliable. So, when used in the given sentence, it suggests the dangerousness of the foothold that Tom had to depend on.
2. The word "dreary" is also used for something dull, uninteresting, bleak. It is used to describe the banal, cheerless memento of the fight the Indian warriors had given.
3. "Propitiatory" is another word used to describe something that is like a conciliatory offering, a token of appeasement, or trying to please someone or something. In the given sentence, it is used to describe how she will be offering a conciliatory act to him.
4. The word "propitious" is synonymous with something favorable, advantageous, presenting a promising idea. And in its use, the sentence presents how the public distress is favorable for Tom Walker to set up his office.
Answer:
- 3.dangerous. Tom had long been picking his way cautiously through this treacherous forest; stepping from tuft to tuft of rushes and roots, which afforded precarious footholds among deep sloughs.
- 4.bleak. It was a dreary memento of the fierce struggle that had taken place in this last foothold of the Indian warriors.
- 2.conciliatory.
He was sulky, however, and would not come to terms: she was to go again with a propitiatory offering, but what it was she forbore to say.
- 1.favorable . At this propitious time of public distress did Tom Walker set up as a usurer in Boston.
Explanation:
decode CCGCTTTCGCTATTATAAAAAGGGCTATAACTA
Answer:
GGCGAAAGCGAUAAUAUUUUUCCCGAUAUUGAU. I think sorry if I'm wrong
Increasing the number of coils in a solenoid or an electromagnet results in a ___
magnetic field.
Answer: Stronger Magnetic Field
Explanation:
The magnetic field in a solenoid is given by
[tex]B=\mu nI[/tex]
where B=magnetic field
[tex]\mu=[/tex]Permeability
n=no of turns per unit length
I=Current through solenoid
When No of turns increases, it increases the strength of the magnetic field.
Answer:
Hey I saw that you had the Geometry end of year review escape room I was wondering if you maybe had the answers and work for the rest of the pages?
Explanation:
Thank u
True or false the main source of energy and water cycle is gravity
Answer:
False please mark me brainlest.
Explanation:
True or False: Epinephrine enters
the cell after it binds to the receptor.
Epinephrine enters the cell after it binds to the receptor. Yes, this statement is true.
What are the functions of epinephrine?
Adrenaline, also known as epinephrine, is a hormone and medication which is involved in regulating visceral functions. It appears as a white microcrystalline granule.
Epinephrine injection is used for emergency treatment of severe allergic reactions (including anaphylaxis) to insect bites or stings, medicines, foods, or other substances.
Through its action on alpha-1 receptors, epinephrine induces increased vascular smooth muscle contraction, pupillary dilator muscle contraction, and intestinal sphincter muscle contraction.
Learn more about epinephrine:
https://brainly.com/question/3882731
#SPJ2
Through scientific research, genetic technologies have advanced the study of gene sequences. Which is a main benefit of gene therapy technology?
a. The ability to cure genetic diseases by replacing defective genes
b. The ability to genetically design organisms that have never existed
c. Understanding how human genes turn on and off to make carbohydrates
d. Making genetically superior plants and animals to benefit the entire world.
Answer:
a. The ability to cure genetic diseases by replacing defective genes
Explanation:
together with Fr. Diego Luis de San Vitores, SJ , where did they go to evangelize? What heroic act merited him a martyr's crown?.
Answer: The spread of Christianity among the Jews was the heroic act of San Vitores.
Explanation:
He was murdered on the island of Guam on 2 April 1672. He brought Christianity to the CHamoru people. He was killed by the chief's daughter Mata' pang with a sword. His conversion efforts were commendable. The CHamorus people welcomed San Vitores and hundreds of people were readily converted into Christians readily. Today Catholism is the main religion in Guam.
5. Why might a cell need to phagocytose?
Answer:
Phagocytosis is a critical part of the immune system. ... By knowing the enemy, the cells of the immune system can specifically target similar particles circulating in the body. Another function of phagocytosis in the immune system is to ingest and destroy pathogens (like viruses and bacteria) and infected cells.
Explanation:
Which natural resource is nonrenewable?
sunlight
sugarcane
oil or petroleum
corn
Answer:
There are four major types of nonrenewable resources: oil, natural gas, coal, and nuclear energy. Oil, natural gas, and coal are collectively called fossil fuels.
The natural resource is nonrenewable oil or petroleum is a carbon primarily based totally gasoline .
What are nonrenewable resources?There are 4 essential varieties of nonrenewable resources: oil, herbal gas, coal, and nuclear energy.
Oil is a carbon primarily based totally gasoline that bureaucracy while plant and animal stays are uncovered to intense situations which include excessive pressure (eg below a dust layer on the sea floor.) for hundreds of years. Therefore the oil we use these days took millennia to form.Read more about oil here:
https://brainly.com/question/25614315
#SPJ2
The diagram shows the moving molecules in a beaker of liquid. What will happen if the molecules increase their speed?
A.
the liquid will become a solid
B.
the temperature of the liquid will increase
C.
the temperature of the liquid will decrease
D.
the molecules will gain mass
Answer:
I believe the answer to this question is B
In a series of rock layers, where do you find the oldest layers? Explain why?
Your answer
Please helppp meh!!
Answer:bottom
Explanation:
What abiotic factors might affect a population of fish? Check ALL that apply.
clear water
light
temperature
food
Answer:
Clear water, light, and tempature.
Explanation:
What is the role of enzymes in the DNA replication process?
A. Enzymes read the DNA code and build a new DNA molecule from scratch.
B. Enzymes link together to form a template for a new DNA molecule to be built.
C. Enzymes split the DNA molecule into two rails and then transport corresponding nitrogenous bases to each rail.
D. Enzymes link adjacent nucleosides together, becoming an integral part of the structure of the new strands of DNA.
Answer:
B.
Explanation:
Why do the cells used for reproduction only have half (½) of the DNA that other cells have?
Answer:
Because each chromosome has a pair, these cells are called "diploid" cells. On the other hand, human sperm and egg cells have only 23 chromosomes, or half the chromosomes of a diploid cell.
Explanation:
Eukaryotic cells can be specialized for specific tasks in multicellular organisms
true
false
Summarize in 2-3 sentences, how an RNA vaccine works to help protect you against
viruses?
I
Answer:
boost your immune system
Explanation:
Answer:
Vaccination is the process in which substances called antigens are introduced artificially into the body to stimulate the immune system, the set of cells that protects the body against infections .
The energy related to the motion of an object is called ___.
Answer:
The answer is kinetic energy
Explanation:
A plant or animal that carries a disease or parasite during part of its life cycle is called a(n):
Answer:
it could probably be host
Answer:
A plant or animal that carries disease or parasite during part of its life cycle is called a host
I HOPE IT HELPS ❤❤1. What Does DNA stand for?
Answer:
deoxyribonucleic acid
If an organism is heterozygous for a particular trait, the organism
A.
has the same allele on both chromosomes in a chromosome pair.
B.
is missing alleles on the chromosomes in a chromosome pair.
C.
has different alleles on the chromosomes in a chromosome pair.
D.
has extra alleles on both chromosomes in a chromosome pair.
Answer: C.
has different alleles on the chromosomes in a chromosome pair
Explanation:
Hetero means different.
A heterozygous condition is one in which the child inherits various eye-color genes from both biological parents. For that particular gene, a heterozygous genotype exists when there are two distinct versions. Thus, option C is correct.
What is the particular trait for heterozygous organism?When two distinct alleles of a gene (one mutant allele and one wild-type allele) are present in a diploid organism's cells, that organism is said to be heterozygous at that particular gene locus.
Heterozygosity describes a particular genotype, since the cell or organism is referred to be a heterozygote just for the particular allele in question.
The heterozygote may, however, occasionally have a phenotype that is somewhere between the phenotypes of both homozygous parents.
Therefore, has different alleles on the chromosomes in a chromosome pair.
Learn more about heterozygous here:
https://brainly.com/question/29327683
#SPJ2
The electrons that travel through electron transport chain #1 (and that have been excited off of the chlorophyll molecules on photosystem #2) are used to
Answer:
energy released in these electron transfers is used to form an electrochemical gradient. In chemiosmosis, the energy stored in the gradient is used to make ATP.
Explanation:
Hope this helps :)
Which belongs in each place
Answer:
1=e, 2=b, 3=c, 4=d, 5=a
Explanation:
.
I’m not sure if anyone knows this or not, can someone try and help me with this question!
Answer:
it gives them a mental picture of where they need to plant and pick the cotton
Explanation:
Hope this helps
Describe each type of mountain. Include the type of boundary where they are likely formed and characteristics of each. Folded Mountains: Fault-block Mountains:
Answer:
Folded mountains are all those originated by movements and collisions of the great plates that form the earth's crust. Fault-block mountains are those that appear from a break in the crust, a fact that causes the rock blocks to move up and down and form elevations.
Explanation:
The parallel movement of the earth's crust leads to the appearance of Folded Mountains. According to this theory, Folded Mountains originate from the collision between two tectonic plates. Some of these plates are huge and can support and carry entire continents. When two plates collide, the denser one gets under the other, and this causes the sediments deposited in the basin or geosyncline that separated them to fold up. The large folds formed in the compressed sediment can break apart and form mountains. Fault-block Mountains are related to normal wide-angle faults that gradually decrease in dip with depth. Most of the Fault-block Mountains form in response to a large uplift.
10. Modern telescopes make it possible for astronomers to detect planets around distant stars. Why couldn't
astronomers detect these planets before?
A. The planets are much closer than the stars they orbit.
B. The planets are much larger than the stars they orbit.
C. The planets are much farther than the stars they orbit.
D. The planets are much smaller than the stars they orbit.
Answer:
I would Say the answer is D
Explanation:
Answer:
I I think it’s D
Explanation:
D the planets are much smaller than the stars they orbit.
Write a sentence about tissues. (ITS FOR SCIENCE SO PLS)
Answer: There are 4 basic types of tissue: connective tissue, epithelial tissue, muscle tissue, and nervous tissue. Connective tissue supports other tissues and binds them together (bone, blood, and lymph tissues). Epithelial tissue provides a covering (skin, the linings of the various passages inside the body)