Help usatestprep need answer

Help Usatestprep Need Answer

Answers

Answer 1

Answer:

one solution

Step-by-step explanation:

they only meet up once

get a new computer br.uh


Related Questions

Answer the questions below. Write your answers in simplest form.
(a) A square has a perimeter of 100 yd. What is the length of each side?
yd

Answers

Answer:

25 yds

Step-by-step explanation:

Since it is a square all sides are equal and there are 4 sides so you divide the perimeter, 100, by 4 to get 25 yds.

help in the next 2 mins!!! -4+7-3

Answers

your answer is 0 your welcome

Answer:

0

Step-by-step explanation:

-4+7-3=0

-4+7=3

3-3=0

Answer is 0

Alexa bought 25 pounds of turkey for $26.25. What is the cost per
pound?

Answers

Answer:

$1.05 Per Pound

Step-by-step explanation:

Answer: $1.05/pound

Step-by-step explanation:

$26.25 / 25 = $1.05

The weight of 100 identical samples of a substance is 0.01 pounds.
What is the weight of 10,000 samples?

Answers

0.01/100 = 0.0001 x 1000 = 0.1lb

Complete the solution of the equation. Find the
value of y when x equals 15.
-x + 2y = -1

Answers

The answer is y = 7

HELP ASAP ILL GIVE BRAINLIEST!!!

At the park, 3/5 of the space is for the playground equipment . Of that space. 1/4 is used for swings. What fraction of the park is used for swings?
3/20

1/5

1/3

4/9

Answers

Answer:

1/5 is ur answer

Step-by-step explanation:

North and South had conflict over which of the following? (lol I accidentally put this as math but it's HISTORY)

A. Slavery

B. Tariffs

C. States' Rights

D. All of the above

Answers

Answer: I think D

Step-by-step explanation: I know slavery and states rights but i don’t know about the b one

Answer: All of the above

Step-by-step explanation: The south wanted slavery, lower or no tariffs, and individualized states writes. On the other hand, the north wanted no slavery, tariffs, and a central government.

A constant volume of cookie dough is formed into a cylinder with a relatively small height and large radius. When the cookie dough is placed into the oven, the height of the dough decreases as the radius increases, but it retains its cylindrical shape. At time t, the height of the dough is 8 mm, the radius of the dough is 18 mm, and the radius of the dough is increasing at a rate of 2 mm per minute.

Part A: At time t, at what rate is the area of the circular surface of the cookie dough increasing with respect to time? (5 points)

Part B: At time t, at what rate is the height of the dough decreasing with respect to time?

Answers

Answer:

a) dA/dt = 125,42 mm/min

b) dh/dt = - 1,78 mm/min

Step-by-step explanation:

The volume of the cylinder is:

V(c) = π*r²*h         ( r and h radius of the base and heigh respectively )

Then the surface area is: Area of the base : π*r²

Plus lateral area :  h*2*π*r

A(c) =  π*r² + 2*π*r*h

With the help of differentials we obtain:

dA/dt = 2*π*r*dr/dt + 2*π*h*dr/dt + 2*π*r*dh/dt        (1)

In this equation and at time t we know:

r = 18 mm        dr/dt = 2 mm/min      h = 8 mm    dh/dt = ??  

dA/dt = increasing rate of the surface area ( with respect to time)

To find dh/dt we know:

V(c) is constant, then

V(c) = π*r²*h     then   h = V(c) / π*r²

dh/dt = - [V(c)*2*π*r*dr/dt ] / π²*r⁴

By subtitution of V(c)

dh/dt = - [ π*r²*h *2*π*r*dr/dt ] / π²*r⁴

dh/dt = - [2*π²h*r³*dr/dt ] /π²*r⁴

dh/dt = - [2*h* dr/dt ] / r

dh/dt =  -  2*8*2 / 18    mm/min

dh/dt = - 1,78 mm/min

By subtitution in equation (1)

dA/dt = 2*π*r*dr/dt + 2*π*h*dr/dt + 2*π*r*dh/dt

dA/dt = 2*π*18*2 + 2*π*8*2 + (- 2*π*18*1,78 )

dA/dt = 226,20 + 100,53 - 201,31

dA/dt = 125,42 mm/min

Following are solutions to the given points:

Formula:

Cylinder volume [tex]v = \pi r^2 h...............(i)[/tex]

[tex]\to \frac{dr}{dt} = 2 \frac{mm}{min}\\\\ \to \frac{dh}{dt} = -2 \frac{mm}{min}\\\\ \to h=8\\\\ \to r=18 \\\\[/tex]

Part A:  

Calculating the circular area of the surface:

[tex]\to A=\pi r^2\\\\[/tex]

So, [tex]\frac{dA}{dt}=2 \pi r \frac{dr}{dt}.........(ii)[/tex]

Therefore

[tex]\to \frac{dA}{dt}= 2\pi \times 18 \times 2= 72 \pi \ \frac{mm^2}{min}\\\\[/tex]

Part B:

[tex]\to \frac{dh}{dt}= - 2 \frac{mm}{min}[/tex]

Learn more:

brainly.com/question/19667963

A submarine dived 172 ft and 4 minutes find the average change in depth from the submarine each minute

Answers

Answer:

43 ft per minute

Step-by-step explanation:

divide 172 by 4 to get the feet per 1 minute

At the beginning of the semester, a professor tells students that if they study for the tests, then there is a 55% chance they will get a B or higher on the tests. If they do not study, there is a 20% chance that they will get a B or higher on the tests. The professor knows from prior surveys that 60% of students study for the tests. The probabilities are displayed in the tree diagram.

A tree diagram. Random student to studies for test is 0.6, and to does not study for test is 0.4. Studies for test to Gets B or higher is 0.55; does not get B or higher is 0.45. Does not study for test to Gets B or higher is 0.20; does not get B or higher is 0.80.

The professor informs the class that there will be a test next week. What is the probability that a randomly selected student studied if they do not pass the test with a B or higher?

0.45
0.46
0.54
0.59

Answers

Answer:

.54

Step-by-step explanation:

The probability is 33%.

what is probability?

The probability is the measure of the likelihood of an event to happen.

Given:

Random student to studies for test is 0.6, and to does not study for test is 0.4.

Studies for test to Gets B or higher is 0.55; does not get B or higher is 0.45.

Does not study for test to Gets B or higher is 0.20; does not get B or higher is 0.80.

P(A) =55%

P(B)= 20%

60% of the students study.

So, the probability that a student studies, and gets B or higher is:

Probability =P(A) * 0.6

P= 55* 0.6

Probability = 33%

Hence, the probability is 33%

Learn more about probabilities here:

brainly.com/question/10837034

#SPJ5

Graph a line through (2,-5) and have a slope of -4

Answers

im sorry: In order to solve the inequality -x > 8, which of the following steps must be done?

Can smoke please help me with this I need help I’ll give brainliest

Answers

Answer:

only one solution at x=0

Step-by-step explanation:

what is the solution of the following? *
-4 = 16
Infinite solutions
no solution

Answers

Answer: no solution

Hope this helps and good luck :)

Step-by-step explanation:

percent change of 14 books to 40 books

Answers

Answer:

185.714285714%

A change from 14 to 40 represents a positive change (increase) of 185.71428571428572%

36 percent sorry if I’m wrong but pls mark me brainleast

The perimeter of a rectangle,p, is given by p =2L + 2W , where L is its length and w is its width what is the perimeter of a rectangle of length 15ft and width 15ft ?

Answers

Answer:girl use google

Step-by-step explanation:what

Question 13 (1 point)
A jug contains 74.1 ounces of fruit punch. If the punch is evenly distributed to six people, how
many ounces will each person get?
oz.
Blank 1:

Answers

Answer:

each person gets 12.35oz

Step-by-step explanation:

74.1

6

=12.35

Answer:

12.35 oz

Step-by-step explanation:

74.1 divided by 6 equals 12.35

WILL MARK AS BRAINLIEST

Answers

Answer:

C!

Step-by-step explanation:

I Got it correct! I hope you have a wondeful weekend and Day!!!

Which trigonometric functions have a domain of [–1, 1]?

Answers

Answer:

A. y = arcsinx and y = arccosx

Step-by-step explanation:

edge

The trigonometric functions have a domain of [–1, 1] is sine and cosine function.

What is Domain?

The range of values that we are permitted to enter into our function is known as the domain of a function. The x values for a function like f(x) make up this set. A function's range is the collection of values it can take as input. After we enter an x value, the function outputs this sequence of values.

Given:

From the given identity, the following things can be interpreted:

cos²x = 1- sin² x

cos x = √(1- sin2x)

Since the cosine function is known to be defined for real numbers, the value contained within the root is always positive. Therefore,

1- sin²x ≥ 0

sin²x ≤ 1

sin x ∈ [-1, 1]

Similarly,

1- cos²x ≥ 0

cos²x ≤1

cos x ∈ [-1,1]

Learn more about Domain here:

https://brainly.com/question/28135761

#SPJ6

solve for x.

12x/5=18

A.x = 43 1/5
B.x =7 1/2
C.x =-7 1/2

Answers

The answer is B. 7 1/2

what is the slope for (1,3) and (1,-2)

Answers

Answer:

-6

Step-by-step explanation:

-2-3/1-1

W =15
2. Marlon buys 9 packs of hot dogs. There are 6 hot dogs in each pack. After
left over. How many hot dogs were eaten?

Answers

How many hot dogs were in each pack

You rode your bike for 5 miles in 30 minutes.
If
you rode at the same rate, you would ride 12 miles in 80 minutes.
12
HINT:
5
30
O True
O False

Answers

it’s False, you’d have to divide the number of minutes by the miles to get how many minutes it took PER mile to ride your bike. 30/5 is 6 therefore it takes 6 minutes per mile. if you were to multiply 6 times 12 miles it would equal 72 minutes.

Write the fraction as a decimal.

16/5

Answers

Answer:

3.2

Step-by-step explanation:

PLEASE HELP QUICKK
Which slopes could be the slopes of perpendicular lines?

Question 1 options:

1/2 and 2


8 and -1/8


2 and 2


1 and -1


0 and undefined

Answers

The answer would be:

8 and -1/8

1 and -1

And could be 0 and undefined, but I'm not 100% sure

Which number is a zero of the function f?
f(x) = x2 - x - 6
F 6
G2
H 3
IO

Answers

Answer:

zeros of the function are −2 and 3

Step-by-step explanation:

there is no -2 so H.3

the answer is a. 6...........

write an equation for each description. solve for x

Answers

Answer:

x = 33

Step-by-step explanation:

Because of the little square we know the total angle is 90

24 + 2x = 90

-24

2x = 66

/2

x = 33

Can you help me please

Answers

Answer:

f(-4)=3(4)^2-5(4)

16*3-20

48-20

f(-4)=28

Susan answered 60% of the test questions correctly. She answered
21 questions correctly. How many questions were on the test?
A. 12.6
B. 56
C. 35
D. 21

Answers

C-35

Times 21 by 100 and divide by 60. (Use the is/of=%/100 method)

twelve increased by a number

Answers

Answer:

12+# OR 12+x

Step-by-step explanation:

Increased by 12 means plus 12. The word "is" in equations is an equal sign. So far, you have 2n+12. On the other side of the equal sign, you have 31 less than 3 times a number.

A stray dog ate 30 of your muffins. That was 5/7 of all of them! How many are left?

Answers

Answer:

42

Step-by-step explanation:

5/7x=30

x=42

Answer:

40

Step-by-step explanation:

Other Questions
Read the following excerpt from "Woman Who Helped Hide Anne Frank Dies at 100" by Teri Schultz.Ms. MIEP GIES: I, myself, I'm just a very common person. I simply had no choice. I could foresee many, many sleepless nights and a life filled with regret if I would have refused to help the Franks. And this was not the kind of life I was looking for at all. SCHULTZ: Gies explained another motivation for emphasizing her modesty. She said if people are allowed to think it takes remarkable qualities to act boldly on behalf of others, few will attempt it. Ms. GIES: People should never think that you have to be a very special person to help those who need you.Which detail best illustrates Miep Giess purpose in this excerpt?People should never think that you have to be a very special person to help those who need you.I could foresee many, many sleepless nights and a life filled with regret if I would have refused to help the Franks.And this was not the kind of life I was looking for at all. Gies explained another motivation for emphasizing her modesty. At a meeting of musicians, 56 of the musicians play the piano but only 35 play the violin. What is the minimum number of people at the meeting who play both piano and violin? |-10| divided by 2 x |5| The graph of the equation x + 3y = 6intersects the y-axis at the point whosecoordinates are: (Find the y intercept)which answer?(0,2)(0,6)(0,18)(6,0) How many men did it take to capture Antigonea. 2b. 5c. 1d. 7 Transcribe the following DNA strand into mRNA and translate that strand into a polypeptidechain, identifying the codons, anticodons, and amino acid sequence.DNA: CGATACAATGGACCCGGTATGCGATATCC Jake walks to town every fifth day. Sam rides his bike to town every fourth day. What is the first day they are likely to meet in town? Why do numA and numB have the same scope in the subtract function? def subtract(numA, numB): return numA - numB def divide(numC, numD): return numC / numD answer = subtract(24,6) print (answer) The coda is considered to be Which process is best illustrated by the diagram? Billy has a gift card with a $160 balance. He buys several video games that cost $40 each. After the purchases, his gift card balance is $40. Enter an equation to help find out how many video games Billy bought. Which fraction is represented by point A on the number line? who want to play among us Celeste transferred 100 percent of her stock in Supply Chain Company to Marketing Corporation in a Type A merger. In exchange, she received stock in Marketing with a fair market value of $562,000 + $562,000 in cash. Celeste's tax basis in the Supply Chain stock was $1,320,000. What amount of loss does Celeste recognize in the exchange and what is her basis in the Marketing stock she receives? QUICKLY PLEASE!!!Respond to the following in three to five sentences.What is the purpose of netiquette guidelines? In an experiment, two unknown compounds (one an ether and the other an amine) of equal molecular mass were dissolved in water. The result of the experiment is shown in the table.Solubility ComparisonUnknown Compound Solubility (g/100 ml water)A 4B 0.25Which of the following correctly explains the identity of Compound A and its solubility? It is an amine; it contains a nitrogen atom that will allow nitrogen-hydrogen bonds to form while in water. It is an ether; because the oxygen atom is within the carbon chain, so it is free to form oxy-hydrogen bonds to make it more soluble. It is an ether; the high polarity of the oxygen-hydrogen bond makes it more soluble. It is an amine; because the lower electronegativity of N than H makes it more soluble. . Why is spell check not completely reliable as an editor? is francium found in nature or lab? what is a film interpretation The students are trying to raise 3.000 but they only have 1200 how much would they need to get to 3000