Answer:
Ca has 20 protons, so neutral it would have 20 electrons, but according to the charge, 2 electrons have been lost.
Explanation:
Which of these is the representative organism for roundworms?
Snail
Spider
Leach
Sponge
Sea star
Coral
Roundworm
Fish
Please help if you know these answers to the water cycle part1
Answer:
Explanation:
1 is water cycle
2 is biosphere
Recent research by Ravizza and colleagues suggests that students may spend as much as one-
typical class hour browsing the internet.
half
third
fifth
quarter
Need help on this question?
Answer:
one-half
Explanation:
According to that study done by Susan Ravizza and her colleagues students spent almost 40 minutes browsing the internet for nonacademic purposes. Since one class period is 100 minutes this would put it at almost one-half of the class period. They also found that the students used their phones for texting for around 27 minutes.
What are some examples of endangered species
Answer:
Black Rhino/Amur Leopard/Bornean Orangutan/Cross River Gorilla
Explanation:
Increased numbers of CAG repeats in the exon of a gene is associated with certain diseases. In a specific gene, the existing CAG codons are in the 'zero' reading frame, in- frame with the AUG initiation codon. The effect of increased numbers of CAG repeats on the encoded protein is:___________. a. to silence of the gene to generate a truncated protein b. to generate a protein with a run of consecutive glutamines c. to generate a frameshifted protein product d. none of the above
Answer:
The correct answer is - option b. to generate a protein with a run of consecutive glutamines.
Explanation:
The initiation code AUG is the code for methionine and as well as the initiation code for the particular protein or peptide chain. In this protein, there is a repeat of CAG is increased with the initiation code so, even though they are in zero reading frame they code for their amino acid which is glutamine.
So. an increased number of CAG repeats will result in a protein with the a run of consecutive glutamines.
Propane is burned to provide the heat in many cooking grills. The chemical
reaction for this process is shown in the equation below.
C3Hg +502 + 3 CO2 + 4H20 + energy
What are the products in this chemical reaction?
A. 3C02 + 4H20+ energy
B. C3H3 + 3C02 + energy
C. C3Hg + 502
O D. 4H20 + 502
Answer:
the products are shown in answer A
Explanation:
Most of the reactions of burning organic substances lead to the products CO2 and H2O and are exothermic.
Which device was not invented in the early 1900s?
Question 7 options:
A)
Electric vacuum cleaner
B)
Electric refrigerator
C)
Electric toaster
D)
Electric car
Explanation:
Electric Vacuum cleaner- 1901
Electric Toaster- 1893
Electric refrigerator- 1913
Electric car - 1884
Answer: Electric Car
Biodiversity is a measure of the:
Answer:
B.
Explanation:
Biodiversity is the diversity (variation) of biology (life). It measures the variation of life within an ecosystem. This directly correlates with B.
Explanation:
combines richness and evenness across species. it is often measured because high biodiversity is perceived a synonymous with ecosystem health
What are the major causes for moving air masses in North America
Answer:
Air masses build when the air stagnates over a region for several days/weeks. To move these huge regions of air, the weather pattern needs to change to allow the air mass to move. One major influence of air mass movement is the upper level winds such as the upper level winds associated with the jet stream.
Explanation:
A major cause for moving air masses in North America is the upper-level winds.
An air mass refers to a large body of air that has identical conditions throughout. It should be noted that air masses take on the condition of the area where they're formed.
Air masses move due to winds and air currents. Moving air masses bring about changes in the weather. The air masses in North America include maritime polar, continental tropical, continental arctic, etc. A major cause for moving air masses in North America is the upper-level winds such as the one that's associated with the jet stream.
Read related link on:
https://brainly.com/question/19087228
Need this asap!!!
The diagram below shows part of the process of DNA transcription. Which
mRNA base will go in location 3?
A.Uracil
B.Thymine
C.Cytosine
D.Adenine
Answer:B
Explanation:
Answer: as of april 25th 2023 its D
Explanation:
thats what i got and i was right also im pretty sure that they switch the order
PLEASE HELP ASAP IM ON A TIMER!!!
This image shows a volcanic eruption in Hawaii with lava flowing into the sea.
This image shows a volcanic eruption in Hawaii with lava flowing into the sea.
Which statement best describes this eruption?
1. Its magma is high in silica.
2. Its magma has low viscosity.
3. Its gases are released in rapid bursts.
4. Its lava came from an explosive eruption.
Answer:
4. its lava came from an explosive eruption
Answer:
4 its lava came from and explosive eruption
Explanation:
If we were to take a journey into ourselves, we would find 23 pairs of chromosomes, or ________ individual chromosomes, all packed in the nucleus of each cell.
Answer: It is 46
Explanation: 23 pairs =46
Q1. Of which wavelength of light do carotenoids absorb the greatest percentage?
a)400nm
b)500nm
c)600nm
d)700nm
Answer:
B. it's between 460 and 550 nm which would put 500 almost directly in the middle
Explanation:
The wavelength of light which carotenoids absorb the greatest percentage is:
B)500nmA wavelength of light is the visible light which the human eye can see. These have different wavelengths of which some are longer than the others, such as the infrared and the ultraviolet rays
A carotenoid is a type of pigment which are yellowish, orange and red and occurs in plants and algae.
As a result of this, we can see that a wavelength of light which carotenoids absorb the greatest percentage is anywhere between 460-550 nM which would fall under the range of option B
Therefore, the correct answer is option B
Read more here:
https://brainly.com/question/6970193
What is the function of a pollen tube?
to lead sperm cells into the ovary
to create more pollen
to create sperm cells
to lead egg cells to the sperm cells
Answer:
The function of the pollen tube is to lead sperm cells into the ovary.
Explanation:
In angiosperms, the pollen tube is a structure formed when the pollen grain comes into contact with the stigma and germinates, producing a tubal extension that is related to the embryonic sac where the female gametophyte is found.
The function of the pollen tube is to conduct the male gametophyte —which is found in the pollen— to the embryonic sac, in order to come into contact with the oosphere and produce fertilization.
The other options are not correct because the pollen tube:
Do not create more pollen. Do not create more male spermatophytes. Does not lead the eggs to the male spermatophytes.Answer: to lead sperm cells into the ovary .
Explanation: There needs to be a way for the sperm cells formed by the pollen's generative nucleus to reach the egg cells that are found in the ovary.
If you do a Gram-stained on a bacteria isolated from a healthy human intestine you will find mostly Gram positive spiral cells.
Select one
True
False
I can help you:)
Most bacteria can be stained with postitevly charged stains.So this is true .My friend had a test about this so he told me all about this topic and helped me learn about it and help you.
so there you go :)
9. What type of bond is pictured in the image below?
a. covalent bond
b. ionic bond
c. metallic bond
d. electron bond
ONLY 9
Answer:
c. metallic bond
Explanation:
Metallic bonding, unlike other forms of atomic bonding, involves delocalized elections. The negatively charged electrons form a "sea" around metal cations. Electrons within the valence shells of metals are only held loosely within their molecular orbits- the metals are held together due to the strong attraction between these delocalized electrons and positive nuclei.
The electrons are typically described as mobile, free, and delocalized. These traits are responsible for several metallic properties such as:
electrical conductivityheat conductivityelectronegativitymalleabilityAnswer: Number 10 is also C
Explanation:
Briefly explain how each layer interacts with electromagnetic radiation from the sun by describing the temperature changes that occur
Explanation:
The layers of atmosphere are differentiated on the basis of different temperature gradients.Thus,different layers within the atmosphere are created.
Toposphere is heated from the ground. Thus, with increase in altitude temperature decreases.
In the stratosphere, temperature increases with altitude. The direct heat source for the stratosphere is the Sun. Air in the stratosphere is stable because warmer, less dense air sits over cooler, denser air.
In Mesosphere temperature decreases with altitude. Few gas molecules present in mesosphere absorb sun's radiation.The heat source is the stratosphere below. The mesosphere is extremely cold, especially at its top, about -90°C.
Thermosphere which also contains ionosphere.The density of molecules is so low in here that one gas molecule could easily go upto 1 km before it collides with another molecule. It is so little energy is transferred, the air feels very cold
Flea
Bird
Caterpillar
Oaktree
А
Look at the ecological pyramid above. What can you tell from this ecological pyramid?
The trophic level of the birds have a lower blomass than the trophic level of the caterpillars.
Fleas belong to the trophic level of primary producers.
The trophic level of the oak trees has the lowest biomass,
All four trophic levels contain consumers.
B
С
D
C2020
Illuminate Education in
Answer:
all of them are.
Explanation:
because all of them are produces for example the life cycle of the Caterpillar First it is a Caterpillar then he is tournd into a pupa then he is a bauterfly then it reproduces and reproduces
Volcanic eruptions cause destruction, but they are also
Answer:
they also form rocks in earth surface
Answer:
Volcanic eruptions may cause destruction but they also create little islands like Hawaii.
Modules Why are fossils an important piece of evidence for evolution? Collaborations?
Answer:
they are inportant because they show us how the animal evolved,why, and when. also they gie us clues about modern day animals
Explanation:
What type of electricity ended up being the one we use in homes?
Question 5 options:
A)
DC
B)
AC
C)
Static
D)
Intra-atomic
Answer:
b
becaus3 tjfjrjfjr tjrjdjdne fjdjd
If cells were a school building, the cell membrane would most likely be represented by which of the following?
А
intercom
B
lockers
С
teachers and students
D
walls and doors
The following DNA is being replicated and the origin of replication is in the middle of the sequence and marked with three stars ***.
5'ATCGGGCTACCCATGAAATGCTAGCATT***TAAGATCTTAAGCTAGCTAGTTCGATCTGA3'
What is the sequence of the primer for the LEADING strand? Your answer should be 8 nucleotides long, written from 5' to 3' and only include the nucleic acid sequence (ex: ACTACTAC).
note: there are two answers for this question
Answer:
5'GATCGTAA3'
5'ATTCTAGA3'
Explanation:
As requested in the question above, the primers were presented with 8 nucleotides, with the nitrogenous bases of the DNA, and in the 5'-3 'direction.
Primers are small fragments of DNA that are used by DNA polymerase to form new strands. The primes attach to pieces on the ribbon, through the complementarity of the nitrogenous bases, serving as a template for the DNA polymerase to create the new ribbon.
DNA polymerase uses primers at the origin of replication, and can follow the path from the right or from the left, depending on the primers used, for this reason, this question has two answers.
Benefits of building dams include
А.Provides year-round water supply for irrigation and use in cities
B.Can produce electricity
С.Can control flooding downstream
D.All the choices are benefits
Answer:
D. All the choices are benefits
Explanation:
Definition: The third planet from the sun.
Example: You are sitting on it, and it's not a chair.
Answer:
Earth
Explanation:
Answer:
earth
Explanation:
because it's the third planet from the sun
hellppppp please will give brainliest
Answer:
B
Explanation:
deciduous Forest...
3
Drag the tiles to the boxes to form complete the pairs.
Match the given changes in the ecosystem to their causes.
Answer:
Explanation:
The correct matches are:
1. Greenhouse gases - Trapping of heat on Earth
When we talk about greenhouse gasses we usually just mean CO2 and methane since they have properties that enable them to trap the heat in the atmosphere. The more we pump these gasses into our atmosphere, the more heat will get stuck and the temperature of Earth will rise and that will lead to many ecosystems dying out.
2. Chemicals released in the river - Unsafe drinking water
When we release chemicals in a body of water either by accident or by not following strict regulations we run the risk of polluting the drinking water and making it unsafe for consumption. This can be because of pesticides or dangerous chemicals from factories or other places.
3. Excess usage of land for agriculture - Fragmentation of forests
When we make more land for our agricultural needs we need to remove forests. During the deforestation, they are if not destroyed then mostly destroyed and this is not something that happens only some times. This is a constant process all around the world and most of this land is being used to feed the animals that we kill for food and not food that we consume directly.
Answer and Explanation:
1.GG=TOHOE Ozone depleting substances - Catching of warmth on Earth
At the point when we talk about nursery gasses we generally mean CO2 and methane since they have properties that empower them to trap the warmth in the environment. The more we siphon these gasses into our environment, the more warmth will stall out and the temperature of Earth will rise and that will prompt numerous biological systems ceasing to exist.
2.CRITR=UDW Synthetic compounds delivered in the stream - Dangerous drinking water
At the point when we discharge synthetic compounds in a waterway either unintentionally or by not after severe guidelines we risk contaminating the drinking water and making it risky for utilization. This can be a direct result of pesticides or perilous synthetic substances from processing plants or different spots.
3.EUOLFA=FOF Overabundance use of land for farming - Discontinuity of backwoods
At the point when we make more land for our rural necessities we need to eliminate timberlands. During the deforestation, they are in the event that not annihilated, at that point generally obliterated and this isn't something that happens just a few times. This is a steady interaction all around the planet and a large portion of this land is being utilized to take care of the creatures that we slaughter for food and not food that we burn-through straightforwardly.
What is the estimated age of Earth?
A.4.6x10^6
B.4.6x10^7
C.4.6x10^8
D.4.6x10^9
Answer:
D: 4.6 x [tex]10^{9}[/tex]
Explanation:
4.6 x 10^{9} = 4,600,000,000
Earth is approximately, 4.6 billion = 4,600,000,000 = 4.6 x 10^{9}
The estimated age of Earth is 4.6x10⁹ years (D).
Scientists estimate the age of Earth through various methods, including radiometric dating of rocks and minerals. By analyzing the isotopes present in rocks and minerals, scientists can determine the decay rates of radioactive isotopes and calculate the time since the formation of those rocks.
Based on extensive studies and evidence, the current estimated age of Earth is approximately 4.6 billion years (4.6x10^9 years). This estimation is supported by multiple lines of evidence, including radiometric dating of rocks from different geological formations, lunar samples brought back from the Moon, and meteorites.
The age of 4.6 billion years is consistent with the age of the oldest rocks found on Earth's surface and the ages of the Moon and meteorites, which are believed to have formed around the same time as Earth. These dating methods provide a reliable framework for understanding Earth's geological history and the processes that have shaped our planet over billions of years.
It's important to note that scientific estimates and understanding of Earth's age continue to evolve as new evidence and research emerge. However, the current consensus among scientists is that the age of Earth is approximately 4.6 billion years, as indicated by extensive geological and radiometric dating studies.
To learn more about Earth, here
https://brainly.com/question/31064851
#SPJ2
5.
20. Given the following scenario, choose the best answer that explains
why it happens: The blue dye in the water traveled up the petals of the
white flower.
How does a new cell become specialized into a heart cell?
A new cell become specialized into a heart cell when its structure can be changed into a heart cell.
When the cell become specialized into heart cell by changing its structure, it will be able to do the function properly. Cell differentiation is that process in which cells become specialized into different types of cells such as heart cell, liver cell etc. A stem cell is an unspecialized cell that change into specialized cells under specific conditions which force the unspecialized cell into specialized cell.
When the heart needs more cells then the stem cells start converting into heart cells by changing its form and structure. These specialized cells go to the place where they are needed the most and start their work so we can conclude that new cell become specialized into a heart cell by changing its structure.
Learn more: https://brainly.com/question/19209945