I need this today please help me


I Need This Today Please Help Me

Answers

Answer 1

Answer: The answer is D

Explanation:

Answer 2

Answer:

Condensation


Related Questions

Summary of natural influences of a savanna.

Answers

Answer:

The African savanna ecosystem is a tropical grassland with warm temperatures year-round and with its highest seasonal rainfall in the summer. The savanna is characterized by grasses and small or dispersed trees that do not form a closed canopy, allowing sunlight to reach the ground. The African savanna contains a diverse community of organisms that interact to form a complex food web.

how many chromosomes do birds have.

Answers

Answer:

80 chromosomes

Answer:

80 Chromosomes

Explanation:

In general, bird karyotypes have a high diploid number (2n) of typically around 80 chromosomes that are divided into macro- and microchromosomes.

I will give brainliest. I will report you if you give me dumb answer

A mutagen is

A.) a living thing that has undergone a mutation.
B.) an agent that causes a mutation in DNA.
C.) a mutation that has affected one gene.
D.) any chemical that can poison living cells.

Answers

its b

A mutagen is a chemical or physical phenomenon, such as ionizing radiation, that promotes errors in DNA replication. Exposure to a mutagen can produce DNA mutations that cause or contribute to diseases such as cancer.

Explanation:

(TRUE OR FALSE)
As discoveries were made that couldn't be explained by spontaneous generations, scientist came up with an updated version of the spontaneous generation model?
PLZ HELP WILL BRAINLIEST
IF U DONT KNOW THE ANSWER DONT U DARE

Answers

Answer: I'm pretty sure this is true

Explanation:

what was abc in duch

Answers

Answer:

ur butthole jasmine

Explanation:

Answer:

Dutch alphabet (Nederlands alfabet)

Dutch alphabet (Nederlands alfabet)Y is also known as Griekse ij, i-grec or ypsilon.

What is Xd and tbh
Pls tell em

Answers

Answer:

tbh means to be honest

XD 1. an expression used in text messages or e-mails signaling happiness or laughter. XD is an emoticon. X represents closed eyes while D stands for an open mouth. OMG! What you did today was so funny!!! XD.

Explanation:

Answer:

XD is a face like a laughing face the X is the 2 eyes crossing and the D is the mouth

Explanation:

eyes↓ ↓mouth

        XD

I NEED THE ANSWER ASAP

which particles do plants absorb to obtain energy?  a. photons  b. electrons  c. atoms  d. molecules

Answers

Answ

i think its a

Explanation:

Answer:

It's a. photons(light energy)

2. How are the kelp and the chemosynthetic bacteria of the
hydrothermal vents similar?
A. Both use energy from the sun to make food.
B. Both are primary producers.
C. Both are scavengers.
D. Both use hydrogen sulfide as an energy source.

Answers

Answer:

C. Both are primary producers.(THIS IS THE CORRECT ANSWER)

Explanation:

Chemosynthesis is a biological conversion of carbon molecules. These are found around the hydrothermal vents.

It is due to the bacteria feeds on the hydrogen sulfide that is coming out from the vents that are required as an energy tonic for the bacteria to survive and kelp also has similar requirements. Kelps forests are shelters for these bacteria and hence both are found near the source of energy.  

Hence the option B both are primary producers.

brainly.com/question/19578387.

Identical twins are genetically the same but do not always look or act exactly alike. Propose a hypothesis to explain this.

Answers

Answer:

It is because no two people should have the same DNA, even twins.

Answer:

Explanation:

The independent assortment of

Extension Questions

12. Scientists may design an experiment with a control group, which is a set of organisms or sam-

ples that do not receive the treatment (the independent variable) that is being tested. Scientists

can then compare normal changes in organisms or samples with those that may have occurred

because of the treatment. The idea of a control group is not the same as a controlled variable.

Suppose a scientist is doing an experiment to determine the effect of an all-organic diet on the

occurrence of cancer in rats.

a. What variables should the scientist control in the experiment?

b. Describe the control group for this experiment.

Answers

Answer:

a) same species of rats

b) Some rats will not be given the all-organic diet

Explanation:

In an experiment, a control group is the group that do not receive the treatment (the independent variable) that is being tested while the control variables or constants are the variables that must be kept constant throughout the course of the experiment in order not to alter the experiment's outcome.

In this experiment where a scientist is trying to determine the effect of an all-organic diet on the occurrence of cancer in rats, the control group would be the GROUP OF RAT THAT DO NOT RECEIVE THE ORGANIC DIET. Also, a control variable would be the SAME SPECIES OF RAT USED throughout the experiment.

Nutrition is a broad field that involves the foods you consume, the nutrient content of those foods, and how those foods and their nutrients affect your health and wellness. Health effects can include how you feel on a daily basis, as well as your risk for certain diseases in the future.
Choose the option below that does not describe the science of nutrition.
A. Many studies have been conducted on the association between certain types of cancer and diet and, therefore, these links are well-understood.
B. Matters surrounding global food supply and food production are integral parts of the study of nutrition.
C. Nutrition science involves the study of the digestion and absorption of food.
D. Recent focus in nutrition science has shifted to the prevention of conditions like heart disease and diabetes

Answers

Answer:

A

Explanation:

The correct option that does not describe the science of nutrition would be that many studies have been conducted on the association between certain types of cancer and diet and, therefore, these links are well-understood.

While truly indeed many studies have been conducted linking certain types of cancer and diet, scientists are far from understanding the link between diets and cancer. While some degrees of understanding exists, it is not 100% certain that there is a cause-effect relationship between these two factors, and a large percentage of cases of cancer are caused by factors that cannot be controlled.

The correct option is, therefore, A.

Explain the 3 types of symbiosis. Give examples of each and explain which organism is benefited, harmed or is neutral to the relationship.

Answers

Answer:

mutualism-commensalism-parasitism.

Explanation:

There are three different types of symbiotic relationships: mutualism, commensalism, and parasitism. Mutualism: both partners benefit. ... Commensalism: only one species benefits while the other is neither helped nor harmed.

Mutualism: both partners benefit. An example of mutualism is the relationship between the Egyptian plover and the crocodile. ...

Commensalism: only one species benefits while the other is neither helped nor harmed. ...

Parasitism: One organism (the parasite) gains, while the other (the host) suffers.

Benifited and harmed :-Mutualism is a symbiotic relationship in which both species benefit. Commensalism is a symbiotic relationship in which one species benefits while the other species is not affected. Parasitism is a symbiotic relationship in which one species (the parasite) benefits while the other species (the host) is harmed.

HOPE MY ANSWER IS HELPFUL

cause of drug addiction.​

Answers

Answer:

The cause of drug addiction is simply because of doing drugs lol

Hope this helped, have a good day

the cause of drug addiction can start by seeing other people do it and maybe you get pressured into it and you end up liking it that you abuse it to where you because addicted even more. This can be the same with nicotine, when they sell you packages from the smoke shop it warns you by saying, “warning this product has nicotine in it. Nicotine can be an addictive chemical.” Most people become addicted to many things after doing it a few times.

I hope this helped

The diagram shows an experiment on the digestion of the protein in egg albumen by protease.
The protease was taken from a human stomach.
In which test-tube will the protein be digested most quickly?
A
B
C
D
water-bath
at 37 °C
egg albumen
egg albumen
egg albumen
egg albumen
protease
dilute
hydrochloric
acid
dilute
hydrochloric
acid
dilute
hydrochloric
acid
protease
boiled protease

Answers

Answer:

C. containing

egg albumen protease dilute  hydrochloric  acid

Explanation:

A protease is a kind of peptidase enzyme that breaks down proteins into peptide molecules. As a digestive enzyme it is located in the lining of the stomach where, relative to the hydrochloric acid in digestive juices, the pH is usually low/ acidic.

Enzymes speed up reaction rates by providing alternative pathways. By modifying the enzyme composition, supplying more collision energy, and changing the collisions between and the ratio of reactants, certain variables will increase the reaction rate.

Proteases function well at 37℃, the typical internal temperature of the human body- this temperature provides adequate energy for the reaction. Similarly, proteases require low pH for the correct configuration, and beyond this pH and temperature, they may become denatured or simply not function well as catalysts.

"

Which of these is purposefully changed during a scientific investigation? (4 points)

a
Test variable (independent variable)

b
Outcome variable (dependent variable)

c
Control group

d
Hypothesis

Answers

Either A or D I’m not 100% sure but it’s the only thing that makes since

Answer:

The answer is A. Test variable (independent variable)! :)

Explanation:

Hope this helps; I took the test and got it correct!!

Don't forget to mark the this Brainliest if this helped! :)

Can y’all please help?

Answers

The chance of the kid having cystic fibrosis is 25%, because there is one square out of four that has two lower case c’s. The genotypes that will express it are cc, because cystic fibrosis is a recessive trait.

What is meant by the word "concentration"'?

Answers

con·cen·tra·tion
/ˌkänsənˈtrāSH(ə)n/
Learn to pronounce
noun
1.
the action or power of focusing one's attention or mental effort.
"frowning in concentration"

How is a cell a system , ANWSER IN YOUR OWN WORDS ?

Answers

Explanation: the movement of organelles and other substances within cells. Endoplasmic reticulum

What is the final product of transcription

Answers

The final product Is called rna

how do skin cells replace itself after an injury?

a) skin cells go through the process of budding to make new identical cells.
b) skin cells go through the procces of mitosis to make new identical cells.
c) skin cells go through the process og photosynthesis to make new identical cells.
d) skin cells go through the process of cellular respiration to make new identical cells.

Answers

Answer:

d

Explanation:

as a result of accumulation of waste products in the body , these substances are removed from the body via the skin hence they undergo cellular respiration

Answer:

b) skin cells go through the process of mitosis to make new identical cells.

Explanation:

The skin is the largest organ in the human body; it forms a protective barrier that keeps out external pathogens, and is integral to waste removal. When the organ is injured, damaged cells initiate an immune response, while healthy cells nearby begin to replicate.

This type of cell replication involves somatic cells and results in the diploid number of chromosomes called mitosis. Skin cells are somatic- they contain all 24 pairs of human chromosomes. During replication, the chromosomes are unwound, and copied- then, the newly copied chromosomes separate into two identical daughter cells with the same chromosome number.

how do the weight of objects on earth compare the weight of the objects on the moon why do you think this is

Answers

Answer:

Being that the moon has a gravitational force of 1.622m/s 2, we multiply the object's mass by this quantity to calculate an object's weight on the moon. So an object or person on the moon would weigh 16.5% its weight on earth. Therefore, a person would be much lighter on the moon. Conversely, a person is 83.5% heavier on earth than on the moon.

Explanation:

hope this helps you out love!! <3

Answer:

weight of objects on EARTH> weight of objects on MOON

Explanation:

weight= mass * gravity

assuming both objects have the same mass, the environment with greater gravity will result in a greater weight

gravity of earth > gravity on the moon

so

weight of objects on EARTH> weight of objects on MOON

Pathogens must be ____ to spread and not all infectious diseases are contagious or cause harm to every animal that hosts it.

Answers

An organism I think, it needs to be alive. All pathogens needs to thrive and survive is a host. The four types of pathogens are all alive like bacteria, fungi, and parasites

The deepest parts of the ocean have much different food chains than most shallow ocean or terrestrial ecosystems. Since there no plants in these areas, Chemoautotrophs usually functions as producers in these ecosystems. Chemoautotrophs are organisms that make their own food using the chemicals found around them. Which statement describes why chemoautotrophs are needed to fill this role in these environments?

A. Plants are unable to survive in salt water

B. Chemoautotrophs have eaten all the plants in the ecosystem

C. Sunlight cannot reach the ocean bottom so the plan are unable to grow

D. Without pollinators, it is impossible for plants to reproduce at greater ocean depths

Answers

Answer: C

Explanation: It is

Answer: C. sunlight cannot reach the ocean bottom so plants are unable to grow

Explanation: The deepest parts of the ocean dont contain plants because the sunlight wouldn’t be able to reach in order for plants to grow. this is why we see plants in the more shallow areas of the ocean.

Meiosis produces which cell type?
haploid
diploid
chromosome
somatic

Answers

Answer:

it produces haploid cells

Explanation:

hope this help :D

it makes haploid cells!!

Please help me! 10 points

Answers

I think Active transport

Fluid in the inner ear creates a sense of ____.

Answers

Answer:

Balance

Explanation:

4. Which of the following statements correctly compares the function of nucleic
acids and proteins?

A. Proteins speed up chemical reactions; nucleic acids provide structural support.

B. Proteins store energy, nucleic acids provide energy

C. Proteins help build cell membranes; nucleic acids store energy

D. Proteins express genetic information; nucleic acids store genetic information

Answers

Answer:

B

Explanation:

Proteins do store energy and nucleic acids provide energy thats why B is correct.

Shontal compared some of the properties of a marble to a piece
of wood. She placed a marble and a piece of wood in a bucket filled
with water. Shontal observed the wood floating on top of the water,
but the marble sank to the bottom of the bucket. Which statement
best explains why the marble and piece of wood acted differently in
the water?
A =The marble contains more mass than the piece of wood
B= The marble was less dense than the water
C=The piece of wood was less dense than the water
D= The piece of wood contained more mass than the marble

Answers

Question

Shontal compared some of the properties of a marble to a piece

of wood. She placed a marble and a piece of wood in a bucket filled

with water. Shontal observed the wood floating on top of the water,

but the marble sank to the bottom of the bucket. Which statement

best explains why the marble and piece of wood acted differently in

the water?

A =The marble contains more mass than the piece of wood

B= The marble was less dense than the water

C=The piece of wood was less dense than the water

D= The piece of wood contained more mass than the marble

depth & density answer im pretty sure is c

After reading the paragraph below, answer the question that follows.Scientists interested in knowing the best way to restore an area after a temporary road was built through it completed a study comparing two treatments: (1) restoring the contour of an area so that there was no longer a depression or cut-through where the road was previously and (2) simply abandoning the area to allow vegetation to return on its own. They wanted to know whether either or both of these treatments would return the aboveground vegetation and the belowground soil properties to their original state, as seen in a similar area where there had never been a road.In this experiment, the area that had never had a road is useful to the experiment because:________________

Answers

Answer:

it acts as the control group in the experiment

Explanation:

The area that had never had a road is extremely useful because it acts as the control group in the experiment. The researchers can use this untouched area of land as a benchmark for the rest of the experiment. Once they implement both test scenarios on the pieces of road, they can then compare the results gathered from each study with the data gathered from the area that had never been a road in order to determine which option provides results that best compare to the original properties of the piece of area that has never been made into a road.

where did genetic engineering come from

Answers

Genetic engineering based on recombination was pioneered in 1973 by American biochemists Stanley N. Cohen and Herbert W. Boyer, who were among the first to cut DNA into fragments, rejoin different fragments, and insert the new genes into E. coli bacteria, which then reproduced.
Genetic engineering based on recombination was pioneered in 1973 by American biochemists Stanley N. Cohen and Herbert W. Boyer,
Other Questions
GIVING BRAINLIEST FOR WHO ANSWERS FIRST! Please help me answer 16 please What month did the October Revolution occur? what were the political limitations of african american during 1865-1900? one paragraph the sunshine Club collected 524 cans for a canned food drive. the cans were then split up equally into 8 boxes. Part A how many can were in each box? Part B how many can were left over after the boxes were filled? Helppp plzz!! A.) Side - Side - SideB.) Side - Angle - SideC.) Angle - Side - AngleD.) Angle - Angle - SideE.) Hypotenuse - LegF.) Not enough information. my picture please hahahahahahah Read the excerpt from The Dark Game: True Spy Stories from Invisible Ink to CIA Moles.Tension between the two sides escalated until June 1948, when the Soviets blocked all western access to the capital. In this first real crisis of the Cold War, the West was not going to be denied by the Soviets.If the underlined word were replaced with the word "event, the tone of the excerpt would bemore resentful.more intellectual.less intense.less objective. how might have the oppressive British rule influenced the ideas of the articles of confederation ? A collection of the same kind of cells working together to do the same job HELP PLEASE ASAP Read the excerpt from "On Becoming an Inventor" by Dean Kamen.When I was twelve years old and Barton, my older brother, was around fifteen, we took over the family basement. At first, I made a darkroom for developing pictures, and Bart was using it as his lab where he was raising about one hundred white rats, removing their thymus glands, and trying to figure out the glands' dysfunction. He wanted pictures taken of his experiment, doing the surgery on rats, and since I already had a darkroom, I took the pictures, though somewhat reluctantly. I didn't like the blood.What can you conclude about Barton from the excerpt?He was interested in solving medical mysteries at a rather early age.He did not understand why Dean would be squeamish about the blood.He went on to become a very famous and successful doctor.He had a severe dislike for rats and all other kinds of rodents. find the slope of the line passing through the points (-5,5) and (-5,-8) What is the unit rate of 232 people in 8 classrooms? i need help with this pleasee five men build a wall in 10 days how long will it take 10 men Anchara drops a penny from a height of 60 feet above the ground. The equation h=-16t^2 + 60 models the penbys height h i feet as a function of time t in seconds whatvare the solutions P3- is a(n) ______________________, so it ________________ valence electrons. Group of answ er choices anion, gained cation, gained cation, lost anion, lost The following DNA is being replicated and the origin of replication is in the middle of the sequence and marked with three stars ***. 5'ATCGGGCTACCCATGAAATGCTAGCATT***TAAGATCTTAAGCTAGCTAGTTCGATCTGA3'What is the sequence of the primer for the LEADING strand? Your answer should be 8 nucleotides long, written from 5' to 3' and only include the nucleic acid sequence (ex: ACTACTAC).note: there are two answers for this question A farmer's market is selling peaches for $2.00 a pound. If you buy 2 pounds, you save 10% on each pound. How much does it cost to get 2 pounds of peaches? 1. What right do education encompasses both entitlements and freedom?A. Right to free and compulsory primary educationB. Right the quality education in private schoolC. Right to choose yourteachersD. All of the above2. Which of the following is an example of non-formal education?A. Primary schoolingB. Senior high schoolC. Adult night classesD. Doctorate program