If the graph of the linear equation ax-8y=15 has an x-intercept at (3,0), then what is the value of a?

Answers

Answer 1
Answer:   a = 5

====================================

Work Shown:

Plug in (x,y) = (3,0)

ax - 8y = 15

a(3) - 8y = 15 .... replace x with 3

3a - 8(0) = 15 ... replace y with 0

3a - 0 = 15

3a = 15

a = 15/3

a = 5

The equation updates to 3x - 8y = 15.


Related Questions

these are two different questions

Answers

Hi sorry I don’t know how to do that but can u tell me how do add 2 picks in a question

What is 3(3t-4)-(2t+10)
plz help

Answers

Answer: 7t-22

Step-by-step explanation:

Did this question in my notes lol

A 5-column table with 6 rows titled Number of cans collected. Column 1 has entries 7, 8, 10, 11, 11, 14. Column 2 has entries 16, 17, 18, 18, 24, 25. Column 3 has entries 28, 29, 30, 30, 35, 37. Column 4 has entries 38, 40, 40, 41, 41, 41. Column 5 has entries 42, 42, 42, 42, 42, 43.
Students from Grover Middle School are recycling aluminum cans. The table shows the total number of cans brought in each school day for a period of six weeks. They collected a total of 862 cans. Use the drop-down menus to define the terms.

Mean:
Median:
Mode:
Range:

Answers

Answer:

mean: 28.73

median: 30

Mode: 42

Range: 36

Step-by-step explanation:

Took the test on edge2020

Answer:

Students from Grover Middle School are recycling aluminum cans. The table shows the total number of cans brought in each school day for a period of six weeks. They collected a total of 862 cans. Use the drop-down menus to define the terms.

Mean:  

✔ 28.73

Median:  

✔ 30

Mode:  

✔ 42

Range:  

✔ 36

Step-by-step explanation:

Correct answers

Natasha rides her bicycle to school. She rides slowly uphill for 5 minutes when she first leaves her house, then speeds up and rides at a consistent speed on flat road for 15 minutes. The last 7 minutes of her ride, she goes faster and faster, flies downhill until she arrives at school. Which graph shows the relationship between Natasha’s speed on her bicycle and time?

Answers

Answer:

B

Step-by-step explanation:

i searched it up

Proporcione un contraejemplo para cada una de estas afirmaciones para demostrar que no son clertas.
Parte A
Todos los cuadriláteros con 4 ángulos rectos son cuadrados

Parte B
Todos los números divisibles por 5 son impares

Answers

Answer:

Can you translate it to English?

Step-by-step explanation:

So I can answer

The sum of two numbers is 2490 and if 6.5 percent of one no. is equal to 8.5 percent of the other, then numbers are ?? Make sure it’s correct answer pls! 20 points for brainliest (also can u tell me how to mark someone brainliest?)

Answers

Answer:

The two number are :

x = 1411

y = 1079

Step-by-step explanation:

Let the two numbers = x and y

The sum of two numbers is 2490

x + y = 2490..... Equation 1

If 6.5 percent of one no. is equal to 8.5 percent of the other,

Hence:

6.5% of x = 8.5% of y

0.065x = 0.085y

Make x the subject of the Formula

x = 0.085y/0.065

x = 1.308y

We substitute 1.308y for x Equation 1

x + y = 2490..... Equation 1

1.308y + y = 2490

2.308y = 2490

y = 2490/2.308

y = 1078.8561525

y = 1079

x + y = 2490..... Equation 1

x = 2490 - y

x = 2490 - 1079

x = 1411

8 True or False: The substitution method is a method of solving systems of equations by adding equations together in such a way that the variables are set aside, one by one.

Answers

Answer: I personally think it's true but I am not for sure

Step-by-step explanation:

The two-way table below describes the practice habits of members of the school band and choir.

Practice Habits of School Musicians


Less than
30 Minutes per Day
At Least
30 Minutes per Day
Band Students
38
26
Choir Students
18
12

Which statement best describes the relationship between the two variables?
There is an association because the relative frequencies by row are different.
There is an association because the relative frequencies by row are similar.
There is no association because the relative frequencies by row are different.
There is no association because the relative frequencies by row are similar.

Answers

Answer:

the answer is c

Step-by-step explanation:

Answer:

the answer is c

Step-by-step explanation:

hope this helps :)

Graph the linear equation -x + 2y = 3 by identifying the x- and y-intercepts ​

Answers

Answer: Hopes this helpss

Step-by-step explanation:

to find the x intercept substitute in 0 for y and solve for x

To find the y-intercept, substitute in 0 for x and solve for y

x intercept (-3,0)

y intercept ( 0, 3/2)

14. A pair of cars, 280 miles apart, begin at the
same time to run toward each other. If car A from
city A runs at a rate that is 10 mph faster than car
B from city B, and if they meet 2 hours later, how
far is the place they meet away from city A?
Please help

Answers

Answer:

Step-by-step explanation:

hi malak

5/9+7/9 in simplest form

Answers

Answer:

1 1/3   one and one third

Step-by-step explanation:

1 1/3

Step-by-step explanation:

This is because 5/9 + 7/9 = 12/9. 12 is a value greater than 9, so you can take one value of 9 out of 12 and get 1 3/9. 1 3/9 can be simplified to 1 1/3 by dividing the denominator and numerator by 3.

Leaving you with 1  1/3

Last month karmin made $480 working for 30 hours this month she will get a 15% increase in the amount she earns per hour what will be her hourly rate In dollars after the increase

Answers

Answer:

$18.40

Step-by-step explanation:

480/30= 16

$16 is the amount earned per hour

16×.15= 2.40

$2.40 is 15% increase in the amount she earns per hour

16+2.40=18.40

$18.40 is hourly rate in dollars after the increase

Buckeye truck rentals has a daily rate of $59.99 plus $0.34/mile. Goodyear truck rentals has the same size truck for 58.95 plus $0.36/mile. At how many mile will the cost be the same?

Answers

Answer:

52 miles

Step-by-step explanation:

Step one:

given data

Buckeye truck rentals

daily rate of $59.99

plus $0.34/mile

let the number of miles be x

and the total charge be y

so

y= 0.34x+59.99---------------1

Goodyear truck rentals

daily rate of 58.95

plus $0.36/mile

let the number of miles be x

and the total charge be y

so

y= 0.36x+58.95---------------2

Step two:

Equate the two equations above to find x

0.34x+59.99=0.36x+58.95

collect like terms

59.99-58.95=0.36x-0.34x

1.04=0.02x

divide both sides by 0.02

x= 1.04/0.02

x=52 miles

Solve the system.

y=6x-1

y=3x-4

The solution is _____
.

Explain your choice of method.

Answers

Answer:

(-1, -7)

Step-by-step explanation:

Solve by graphing.

Graph the two equations together.

The lines intercept at (-1, -7).

Hope this helps.

Answer:

Solution: (-1, -7)

Step-by-step explanation:

6x - 1 = 3x - 4

Subtract 3x from both sides;

3x - 1 = -4

Add 1 to both sides;

3x = -3

Divide both sides by 3;

x = -1

Substitute x into the equation;

y = 3(-1) - 4

y = -3 - 4

y = -7

The line graphed below has a slope of ____.

3
1/3
-3

Answers

It is -3 because it had a negative slope

Answer:

-3

Step-by-step explanation:

Hope this helps!

Jayson buys a car and pays by installments. Each installment is $567 per month.
After 48 months, Jayson owes $1,250. What was the total price of the vehicle?

Answers

Answer:   $28,466

================================================

Explanation:

Each installment or payment is $567 per month.

If 48 months go by, then Jayson has paid 48*567 = 27,216 dollars.

If he still owes $1250, then this means he will pay back a total of 27,216+1,250 = 28,466 dollars.

what is 4613203.125 rounded as a whole number​

Answers

Answer:

4613203

Step-by-step explanation:

To round as a whole number, take the decimals and see what the first number of the decimal is. if the number is 5 or more, its 1 more number. if its lower than 5, its not a whole number.

What is the value of the expression of -(-4)

Answers

Answer:

4

Step-by-step explanation:

two negative signs are equal to a positive sign

Pls help I really need it

Answers

Answer:

x = 20

p =54

y= 54

Step-by-step explanation:

2x-4 = 96-3x

5x = 100

x = 20

2x-4 = 40-4 = 36

(180 - (36 x 2))/2

(180-72)/2

108/2

p = y =54

2.526 - 3.628 =
i know there is a calculator for this but i need to show it in work so PLEASE RESPOND! (Thanks if u do)

Answers

Answer:

1.102

3 . 6 2 8

- 2 . 5 2 6

1 . 1 0 2

So 2.526 - 3.628=-1.102

-1.102 is your answer

Solve 2x2 + 3x = 20.

A. x = −10 and x = 3
B. x = five over two and x= −4
C. x = 5 and x = 2
D. x = negative five over two and x = −4

Answers

Answer:

x=5/2 or x=-4

Step-by-step explanation:

Answer:

B

Step-by-step explanation:

Hope this helps!

Kim accidentally leaves the water hose running for half a day the graph represents the loss of water during that time ​

Answers

fifijfjgjgfghj

Step-by-step explanation:

Answer:

We need to see the graph to help you

Step-by-step explanation:

Kijuan needs to buy eggs to make breakfast for the next week. Each carton of eggs holds 12 eggs. Which of the following equations represents the relationship between the number of eggs that Kijuan will , y, and the number of cartons he buys, x ?

Answers

Answer:

[tex]\int\limits^a_b {x} \, dx[/tex]

Step-by-step explanation:

Which rectangles similar to the one below?

Answers

Answer:

D

Step-by-step explanation:

because half of 8 and 14 is 4and 7

!!IMPORTANT!! 10 POINTS!!
Francis is playing an online puzzle game. He has 25 points and earns 5 points for puzzle he solves correctly. He will advance to the next round if his score is over 75 points. Which inequality can Francis use to find how many more puzzles he must solve to advance to the next round?

Answers

Answer:

x>10

or

5x+25>75

Step-by-step explanation:

Answer:

25 + 5x > 75

Step-by-step explanation:

Let x be the number of puzzles Francis needs to solve to advance to the next round.

25 points + (No. of rounds × Points per round) is more than 75 points.

25 points: 25

(No. of rounds × Points per round): 5x

is more than: >

75 points: 75

25 points + (No. of rounds × Points per round) is more than 75 points:

25 + 5x > 75

What value of x is in the solution set of 2x. 3 > 11 - 5x?

a. -3
b. 0
c. 2
d. 4​

Answers

Answer:

i think option d

Answer:

The answer is D : 4.

Step-by-step explanation:

=2x-3>11-5x

=2x-3+5x>11

=7x-3>11

=7x>11+3

=7x>14

=7x/7>14/7

=x>2

By simplifying the problem, you can see that "x" must be greater than 2. Therefore, eliminating all other possible answers that are shown, but 4.

I answered the same questions with the same exact wording and explanation so please don't report any answers that are the same as this one, they are all mine and written by me.

For every 242424 meals Momoka prepared for customers last night, she prepared 222 meals for employees. Momoka prepared 156156156 meals. How many meals did Momoka prepare for customers and for employees last night?

Answers

9514 1404 393

Answer:

13 meals for employees143 meals for customers

Step-by-step explanation:

2/24 = 1/12 of the 156 meals were for employees. That is ...

  156/12 = 13 meals . . . . for employees

The remaining 156 -13 = 143 meals were for customers.

What is 3 /49 as a decimal?

Answers

Answer: 3/49 as a decimal is 0.06122

Can anyone please help me on this!? I’ll give brainliest!

Answers

Answer

Step-by-step explanation:

Write the equation of a cubic polynomial in standard form with root at 1 and double root at -5, passing through the point (3,32).

Answers

it would be 4 because yes
Other Questions
(Im in a rush to get this answered,Im taking a test) What was one effect of the State Colonization Law of 1825?A. Mexico gained its independence from Spain.B. San Antonios population reached 20,000.C. Slavery was banned in Texas.D. The Old Three Hundred were recruited to settle Texas. please help me I don't answer this I'll give brilliance What is the graph of the linear function that is represented by the equation y= 1/2x-2 25 POINTS AND BRAINLIEST!! Clay wants to ride a Ferris wheel that has a radius of 80 feet and is suspended 9 feet above the ground. The wheel makes 6 revolutions in one minute. Find the period and amplitude. Read the following excerpt from "Woman Who Helped Hide Anne Frank Dies at 100" by Teri Schultz.Ms. MIEP GIES: I, myself, I'm just a very common person. I simply had no choice. I could foresee many, many sleepless nights and a life filled with regret if I would have refused to help the Franks. And this was not the kind of life I was looking for at all. SCHULTZ: Gies explained another motivation for emphasizing her modesty. She said if people are allowed to think it takes remarkable qualities to act boldly on behalf of others, few will attempt it. Ms. GIES: People should never think that you have to be a very special person to help those who need you.Which detail best illustrates Miep Giess purpose in this excerpt?People should never think that you have to be a very special person to help those who need you.I could foresee many, many sleepless nights and a life filled with regret if I would have refused to help the Franks.And this was not the kind of life I was looking for at all. Gies explained another motivation for emphasizing her modesty. At a meeting of musicians, 56 of the musicians play the piano but only 35 play the violin. What is the minimum number of people at the meeting who play both piano and violin? |-10| divided by 2 x |5| The graph of the equation x + 3y = 6intersects the y-axis at the point whosecoordinates are: (Find the y intercept)which answer?(0,2)(0,6)(0,18)(6,0) How many men did it take to capture Antigonea. 2b. 5c. 1d. 7 Transcribe the following DNA strand into mRNA and translate that strand into a polypeptidechain, identifying the codons, anticodons, and amino acid sequence.DNA: CGATACAATGGACCCGGTATGCGATATCC Jake walks to town every fifth day. Sam rides his bike to town every fourth day. What is the first day they are likely to meet in town? Why do numA and numB have the same scope in the subtract function? def subtract(numA, numB): return numA - numB def divide(numC, numD): return numC / numD answer = subtract(24,6) print (answer) The coda is considered to be Which process is best illustrated by the diagram? Billy has a gift card with a $160 balance. He buys several video games that cost $40 each. After the purchases, his gift card balance is $40. Enter an equation to help find out how many video games Billy bought. Which fraction is represented by point A on the number line? who want to play among us Celeste transferred 100 percent of her stock in Supply Chain Company to Marketing Corporation in a Type A merger. In exchange, she received stock in Marketing with a fair market value of $562,000 + $562,000 in cash. Celeste's tax basis in the Supply Chain stock was $1,320,000. What amount of loss does Celeste recognize in the exchange and what is her basis in the Marketing stock she receives? QUICKLY PLEASE!!!Respond to the following in three to five sentences.What is the purpose of netiquette guidelines? In an experiment, two unknown compounds (one an ether and the other an amine) of equal molecular mass were dissolved in water. The result of the experiment is shown in the table.Solubility ComparisonUnknown Compound Solubility (g/100 ml water)A 4B 0.25Which of the following correctly explains the identity of Compound A and its solubility? It is an amine; it contains a nitrogen atom that will allow nitrogen-hydrogen bonds to form while in water. It is an ether; because the oxygen atom is within the carbon chain, so it is free to form oxy-hydrogen bonds to make it more soluble. It is an ether; the high polarity of the oxygen-hydrogen bond makes it more soluble. It is an amine; because the lower electronegativity of N than H makes it more soluble.