Answer:
THE ANSWER IS THE SNAKE
Explanation:
PLEASE MARK ME AS BRAINLIEST
Can u pls help me this is due today I will give brainliest
Answer:
exmaple z
Explanation:
it is the heaviest so it would require more to push
What size molecules can pass through a cell membrane by a process called passive transport?
Answer:
diffusion and osmosis
Explanation:
lipid_ soluble substance
through lipid baleyer
through protein channel
Transported proteins carry small substances like water, amino acids, and charged ions. One to fifteen angstroms is the range in molecule size that can pass through the membrane. The easier it is for a molecule to move across the cell membrane, the smaller it is.
What is cell membrane ?All cells have a cell membrane, also known as a plasma membrane, which separates the interior of the cell from the external environment. A semipermeable lipid bilayer makes up the cell membrane. The movement of materials into and out of the cell is controlled by the cell membrane.
Small molecules or ions can traverse the cell membrane passively without the cell providing any energy. The three basic types of passive transport are osmosis, assisted diffusion, and diffusion.
Gases like oxygen and carbon dioxide, as well as small hydrophobic compounds, quickly traverse membranes. Water and ethanol are examples of small polar molecules that can move across membranes, though more slowly.
Thus, The easier it is for a molecule to move across the cell membrane, the smaller it is.
To learn more about cell membrane, follow the link;
https://brainly.com/question/13524386
#SPJ2
Interphase
21. Before Meiosis, comes
cell activities, like making
During interphase, the ce
for example.
22. Uncoiled stringy DNA is called
write the code for RNA from this DNA STRAND :
AAAAAATTTTTTCCCGGGGTTTATATATC
Answer:
UUUUUUAAAAAAGGGCCCCAAAUAUAUAG
Explanation:
All you have to do is apply the same concept as DNA, but T (Thymine) is replaced with U (Uracil)
the receptionist said to the manager,'I have booked your flight tickects for Monday'. change into imdirect speech
Answer:
The correct answer is- The receptionist told the manager that he had booked his flight tickets for Monday
Explanation:
Indirect speech is the expression any statement of a consverstaion that occured in past without quoting explicitly. Indirect speech is the stating any quoted statement in simple statement. In this type of speech some grammer and certain noun and pronoun change accordingly.
So the correct indirect speech of the receptionist said to the manager,'I have booked your flight tickects for Monday'. would be The receptionist told the manager that he had booked his flight tickets for Monday
Which of these is an advantage of fossil fuels? *
O Reliable
O Large reserves
O Greenhouse gas emissions
O Non-renewable
Answer:
reliable
Explanation:
Explanation:
Fossil fuels are a non-renewable resource.
Do humans and plants get their nutrients the same way?
Answer:
As humans require a lot of nutritious food for the growth, same way plants also require nutrients in order to grow. Plants which are grown in the soil gets all the required nutrients from the fertilizers and from the land where natural nutrients are stored.
Someone help me match the last two to their definition
Hypotonic and Isotonic
Certain gene mutations can cause genetic disorders. However the same gene can also have a positive effect. The genetic mutation that led to sickle cell anemia can also give its carriers protection from which of the following diseases?
A.
strep throat
B.
Type I diabetes
C.
malaria
D.
hemophilia
Answer:
its malaria
Explanation:
I got it wrong and it showed me that it was malaria
Which macromolecule plays a central role as an energy source?
Answer:
Carbohydrates
Explanation:
Ex: Glucose (monosaccharide)
Why does DNA need to make a transcript of itself and what is this transcript called?
Answer:
DNA needs to be transcribed itself as a mechanism for the multiplication of its molecules, and this transcription process is called DNA replication.
Explanation:
DNA replication is a mechanism that allows it, from one molecule, to obtain two molecules identical to the original. In other words, it transcribes the information from one of its strands to a new strand.
The process of DNA replication is semi-conservative, because each new molecule is formed by an original strand and a new strand, which contributes to maintaining the integrity of the genetic information.
As a requirement of the cell division process, as mitosis, DNA must replicate so that each daughter cell has the same genetic information as the original cell. This is why replication of this nucleic acid occurs.
it takes 25 min to cook 10 egg how long does it take to cook 20
Answer:
it takes 50 min
Explanation:
20 is twice of ten so if it take 25 min to cook ten then it is 50 min to cook 20.
Work for it:
10 x 2 = 20
10 eggs=10 min
25x2=50
Answer:
it takes 50 minutes to cook 20 eggs
Explanation:
ok first you have to see how long it takes 1 egg to cook so 25/10=2.5minute an egg then u multiply 2.5 x 20=50
hope this helps
Pls help me
10 points
If a defendant appeals the verdict from a state court of last resort, which
court would most likely hear the appeal next?
A. An intermediate appellate court
B. The U.S. Supreme Court
C. A federal district court
D. A municipal court
SUBMIT
Answer:
b
Explanation: peeps in washington are going crazy.
ANY ALT PEOPLE HERE
Answer:
LOL THIS IS NOT THE PLACE FOR THIS XDDDDDD
Explanation:
Answer:
thanks for the points
Explanation:
1. Energy transfer is inefficient between trophic levels because
A. Molecules are fully digested from each trophic level.
B. Dead organisms and waste are recycled throughout the trophic levels.
C. Organisms within a trophic level are fully consumed.
D. All organisms within a trophic level die.
2. Primary productivity is defined as
A. The rate that plants and other photosynthesis organisms produce organic compounds.
B. The process where green plants and some other organisms convert light energy into chemical energy using carbon dioxide and water.
C. The overall amount of energy captured by plants and other photosynthetic organisms by the chloroplast.
D. The adjusted amount of energy in an ecosystem due to energy use by organisms for respiration.
Thanks if you help, It's highly appreciated. :-)
Answer: b dead organisms And waste are recycled throughout the tropic levels.
Explanation:
Answer:
part 2
the rate that plants and other photosynthetic organisms produce organic compounds.
Explanation:
:)
When the northern hemisphere points toward the sun, the southern hemisphere faces away from the sun. In this instance, it is:
A.
summer in North America, and winter in Australia.
B.
summer in North America and Australia.
C.
winter in North America, and summer in Australia.
Answer:
A
Explanation:
the northern hemisphere is the opposite from the southern hemisphere
Since northern and southern hemisphere are in opposite directions therefore, option (A) is correct.
Why are the seasons reversed in each hemisphere?The axis of rotation of the Earth is inclined with regard to the plane in which it orbits the sun. This is the root reason of the changing of the seasons. When the axis of the earth is aligned with the sun, summer arrives in that hemisphere of the planet. Expect winter to arrive when the axis of the earth is tilted away from the sun.
Different places of Earth receive the Sun's most direct rays throughout the year. When the North Pole tilts toward the Sun, it's summer in the Northern Hemisphere. When the South Pole tilts toward the Sun, the Northern Hemisphere experiences winter.
Learn more about seasons, here:
https://brainly.com/question/12028829
#SPJ2
Which term describes a pure substance that is made up of only one type of atom?
O matter
Orock
O compound
o element
In the seventeenth century, Francesco Redi performed experiments using raw meat placed in jars.
• Half of the jars were covered, and half were left open,
• Redi noticed that the meat in the sealed jars did not have maggots, but the meat in the open jars did have maggots.
Redi concluded that only flies could make more flies,
.
Which part of the cell theory corresponds to Redi's findings?
Answer: B
Explanation:
''New cells come from the existing cells'' is a part of the cell theory which corresponds to Redi's findings.
Experiment performed by Francesco RediFrancesco Redi conducted an experiment in which he showed that living organisms come from other living organisms. This worked combine with the work of other later scientists, helped to develop the third part of the cell theory which is cells come from other living cells.
Learn more about cell theory here: https://brainly.com/question/3966602
The division of the cytoplasm, which follows Mitosis, is called...
Answer:
Cytokinesis,
Explanation:
Cytokinesis, the division of the cytoplasm to form two new cells, overlaps with the final stages of mitosis. It may start in either anaphase or telophase, depending on the cell, and finishes shortly after telophase.
The division of the cytoplasm, which follows Mitosis, is called Cytokinesis. This is further explained below.
What is Mitosis?Generally, Mitosis is simply defined as a kind of cell division that produces two daughter cells with the same number and type of chromosomes as the parent nucleus, as seen in normal tissue growth.
In conclusion, Cytokinesis is simply defined as the division of the cytoplasm that occurs after mitosis to produce two daughter cells.
Read more about Cell
https://brainly.com/question/2622341
#SPJ2
20 points and will mark brainliest!! Explain how you got it!
Answer:
OF COUSE IT C
Explanation:
Answer:
C
Explanation:
I think the answer is C.
The different kinds of water effects the water and the sunlight. This helps show how much water and sunlight each plant gets and it will bring results.
I hope this helps you! Have a great day!
What controls the cell cycle at key checkpoints?
a Regulatory proteins
b Regulatory lipids
C Regulatory carbohydrates
Answer:
a regulatory proteins
Explanation:
njnjnj
7. What is a layout of chromosomes in humans in order from largest to smallest with the
sex chromoosomes at the end called?
Answer:
Look down!!! ;)
Explanation:
In a human karyotype, autosomes or “body chromosomes” (all of the non–sex chromosomes) are generally organized in approximate order of size from largest (chromosome 1) to smallest (chromosome 22). However, chromosome 21 is actually shorter than chromosome 22.
Hope this helps!! ;)
Why are the rocks on the bottom folded but the top ones are not? What could’ve caused this?
Answer: The basic answer could be because of the tectonics plates.
Explanation: Because when two forces act towards each other from opposite sides, rock layers are bent into folds.
Typically, sedimentary rocks are arranged in layers, one on top of the other, the oldest items are listed last, followed by the youngest, this is the concept of "superposition.
Why are rocks folded?Erosion has removed the top layers of the rocks, resulting in the formation of valleys and hills, the top layer might be penetrated with sufficient power. The plates might shift due to erosion, and plate movement.
Many of the stratified rocks, however, are no longer horizontal, we know that sedimentary rocks that are not horizontal either were created in unique ways.
Therefore, more frequently, were shifted from their horizontal position by subsequent processes, such as tilting during episodes of mountain construction, thanks to the Law of Original Horizontality.
Learn more about rocks, here:
https://brainly.com/question/29561452
#SPJ2
what is the function of mitrochondria
Answer: Mitochondria are membrane-bound cell organelles (mitochondrion, singular) that generate most of the chemical energy needed to power the cell's biochemical reactions. Chemical energy produced by the mitochondria is stored in a small molecule called adenosine triphosphate (ATP).
Explanation:
Answer: The mitochondrionis a double membrane-bound organelle found in most eukaryotic organisms. Some cells in some multicellular organisms lack mitochondria (for example, mature mammalian red blood cells). A number of unicellular organisms, such as microsporidia, parabasalids, and diplomonads, have reduced or transformed their mitochondria into other structures.
Explanation:
(Many points) PLS HELP QUICK dont guess answer pls ad dont say random answers for points pls
Cheng made a chart to list the functions of certain fish structures.
(The image below)
Which headings correctly complete the chart?
X: Fin
Y: Swim bladder
Z: Lateral line
X: Fin
Y: Lateral line
Z: Swim bladder
X: Lateral line
Y: Swim bladder
Z: Fin
X: Lateral Line
Y: Fin
Z: Swim bladder
Answer:
x:fin
y:lateral line
z:swim bladder
Answer: The answer for this question is Fin for x Lateral line for y and
swim bladder for z
Explanation:
I took the test
how do you think the idea of sustainability influences the work of foresters?
help me
what direction was the texas annexation in?
Bacteria reproduce in a process called binary fission which of the following is true about binary fission?
Which best describes the relationship between DNA, genes, and chromosomes?
DNA are segments of genes that form tight coils called chromosomes.
Genes are segments of DNA that form tight coils called chromosomes.
Chromosomes are segments of DNA that form tight coils called genes.
Genes are segments of chromosomes that form tight coils called DNA.
Answer:
genes are segments of chromosomes that form tight coils called dna
The statement that best describes the relationship between DNA, genes, and chromosomes is as follows:
Genes are segments of chromosomes that form tight coils called DNA.Thus, the correct option is D.
What is Chromosome?A Chromosome may be defined as a thin thread-like structure that appears during the process of cell division. Such types of thread-like structures are significantly present in the nucleus of the cell.
Chromosomes are made up of DNA, RNA, histones, and some non-histone proteins. Chromosomes were first discovered by E. Strausburger in 1875.
Genes are small stretches that significantly considered the segments of chromosomes. Together they form a tightly coiled structure remarkably known as DNA. Genes carry nucleotide sequences that can produce functional enzymes or proteins.
All such parts carry genetic information with respect to the existence of organisms on the basis of morphology and function.
Therefore, the correct option for this question is D.
To learn more about Chromosomes, refer to the link:
https://brainly.com/question/11912112
#SPJ6
MULTIPLE CHOICE QUESTION
Are a majority of the problems associated with down syndrome a result
of an over or under expression of chromosome 21?
under
over