Please Help!
The middle of an mRNA molecule contains the nucleotide sequence shown here. Much more of the mRNA is translated. Assume that the sequence is translated from left to right.

AUUUAACUGUUCUGUCUAGAG


1.

Construct an Explanation Based only on the information provided, why could the mRNA section be translated into three different sets of amino acids, instead of just one set?

2.

Use Models Use the genetic code to translate the sequence into each of the three possible sets of amino acids.

3.

Draw Conclusions Which of the three sets of amino acids is the most likely to be included in the polypeptide? Explain your reasoning.

Answers

Answer 1

Answer:

TAA ATT GAC AAG ACA GAT CTC

1. The more bases there are per codon the more information you can code for. There are only 22 different amino acids, in consequence we need minimum 3 bases per codon.

2. codon

three nucleotides—called a triplet or codon—codes for one particular amino acid in the protein. The nucleotide sequence in the DNA is first transcribed into a molecule of messenger RNA (ribonucleic acid).

3. Known as alpha helices and beta sheets, these stable folding patterns make up the secondary structure of a protein. Most proteins contain multiple helices and sheets, in addition to other less common patterns (Figure 2). The ensemble of formations and folds in a single linear chain of amino acids — sometimes called a polypeptide — constitutes the tertiary structure of a protein. Finally, the quaternary structure of a protein refers to those macromolecules with multiple polypeptide chains or subunits.

OKAY I THINK EVERYTHING IS RIGHT BUT SORRY IF WRONG ;)

Answer 2
The mRNA sequence could be translated into three different sets of amino acids because of the degeneracy of the genetic code.
Using the genetic code to translate the mRNA sequence, we get the following three possible sets of amino acids:Set 1: isoleucine-phenylalanine-leucine-serine-valine-arginineSet 2: isoleucine-asparagine-valine-leucine-serine-arginineSet 3: isoleucine-asparagine-leucine-serine-valine-arginine

3. It is not possible to determine which of the three sets of amino acids is the most likely to be included in the polypeptide based solely on the information provided.

What is a nucleotide sequence?

A nucleotide sequence is the order of nucleotides (the building blocks of nucleic acids) in a DNA or RNA molecule.

Nucleotides are composed of a sugar, a phosphate group, and a nitrogenous base, which can be adenine (A), cytosine (C), guanine (G), thymine (T) (in DNA) or uracil (U) (in RNA). The specific order of these nucleotides in a DNA or RNA molecule determines the genetic information that the molecule carries.

Learn more about nucleotide sequence, here:

https://brainly.com/question/30299889

#SPJ6


Related Questions

When a person's temperature gets too high, they will automatically sweat to cool down.
Sweating is considered a ___________________.

Answers

Answer:

Perspiration

Explanation:

If you had options that could have helped but I think perspiration is the correct answer.

Hope this helps :D

NS
What are magnetic field lines?
A. Lines that show the shape of a
magnetic field
B. Lines that show the path of electrons
C. Lines that show aligned atoms

Answers

Answer:

A

Explanation:

Magnetic field lines are a visual tool used to represent magnetic fields. They describe the direction of the magnetic force on a north monopole at any given position. The density of the lines indicates the magnitude of the field.

A type of plant that has cells inside that form long tubes and carry nutrients and water is called _____________.

Answers

Answer:

It is called a Vascular tissue.

Explanation:

Hope this helped ;)

If you what more answer use Socratic app

____ can be used for different types of surgery.
a. Lenses
b. Lasers
c. Diffractions
d. Refractions
(Lasers)

Answers

Answer:

lenses can be used for diffrent types of surgery

How might it be possible for your baby to show a trait that neither you or your mate has?

Answers

Answer:

it could be passed on from generations, even though if your mother or father doesn't have those traits

what type of EM waves are used to observe objects from outer space

Answers

Answer:

Space telescopes can carry instruments to observe objects emitting various types of electromagnetic radiation such as visible, infrared or ultraviolet light; gamma rays; or x-rays. X-ray telescopes, such as the Chandra X-ray Observatory, use X-ray optics to observe remote objects in the X-ray spectrum.

Explanation:

becuse u ugly jk jk jk im not serious ok

Type of EM waves used to observe objects from outer space would be infrared, ultraviolet light, gamma rays, and x-rays

Priscilla was building a circuit that used copper wires to connect a battery to a light bulb. As she connected the final wire from the light bulb back to the battery, the light bulb turned on. Priscilla knew that current was now flowing through her closed circuit. What makes the current in the circuit flow?

Answers

Answer:

The complete path provided by the closed circuit enables electric current produced by the battery to flow round the circuit

Explanation:

Electric current consists of charges (electrons) in motion from one region to another.

An electrical circuit is any closed path through which electric current can flow.

An electrical circuit consists of an energy source that supplies the electrons moving, a path along which the electrons can travel, and a load or appliance that uses the electrical energy. When the circuit is broken at any point, electrons will cease to flow since there is no complete path for it to flow. Such a circuit is known as an open circuit.

In the circuit built by Priscilla, the battery serves as a source of energy by providing the electrons that moves round the circuit. The wires provides the path for electrons to flow from the battery through the light bulb and back to the battery. When she connected the final wire from the bulb back to the battery, the circuit becomes complete/closed and current then flows to light up the bulb.

How do I fly? :(;):)

Answers

Answer:

Hm

Explanation:

Try a few things like an airplane, jetpack, etc

By flying and flying and Flying some more

what animals eat leafy sea dragons? also want to do leafy sea dragons eat?

Answers

Answer:

(1) In the wild, young sea dragons are preyed upon by other fish, crustaceans and even sea anemones.

(2) Leafy seadragons eat small, plankton crustaceans.

When making a Punnett square the alleles of the mother and father are written at the top and side of the four square box. True or False

Answers

It is True that when making a Punnett square the alleles of the mother and father are written at the top and side of the four square box.

Answer:

True

Explanation:

There is one letter per box on the top two, and left two.

The sun, rocks, water are all example of...

Answers

Answer:

are examples of abiotic factors

Explanation:

I think it’s natural resources.

Which nutrient cycle has no Gas Phase?

Answers

Answer:

Describe the steps that you would take to effectively prepare for a discussion about a debatable issue.

Explanation:

Plants receive carbon dioxide through their ____________.

Answers

Answer:

leaves,stomata

Explanation:

The carbon dioxide enters the leaves of the plant through the stomata present on their surface.

Answer:

Carbon dioxide enters through tiny holes in a plant's leaves, flowers, branches, stems, and roots.

Explanation:

pls help!!

Which row shows the chambers of the heart, from those with the thickest walls to those with the
thinnest walls?
from top to bottom it goes from the thickest to thinnest
A.
atria
left ventricle
right ventricle
B
atria
right ventricle
left ventricle
с
left ventricle
right ventricle
atria
D
right ventricle
left ventricle
atria

Answers

The answer is: B Atria, Right Ventricle, Left Ventricle
The right and left atria because they are low-pressure chambers that serve as storage units and conduits for blood so they would be the thinnest

List and explain the 3 paths natural selection can take.

Answers

Answer:

1. Stabilizing Selection  

2. Directional Selection  

3. Disruptive Selection  

Explanation:

Stabilizing Selection  

This type of natural selection occurs when there are selective pressures working against two extremes of a trait and therefore the intermediate or “middle” trait is selected for. If we look at a distribution of traits in the population, it is noticeable that a standard distribution is followed:

Example:  For a plant, the plants that are very tall are exposed to more wind and are at risk of being blown over. The plants that are very short fail to get enough sunlight to prosper. Therefore, the plants that are a middle height between the two get both enough sunlight and protection from the wind.

Directional Selection  

This type of natural selection occurs when selective pressures are working in favour of one extreme of a trait. Therefore when looking at a distribution of traits in a population, a graph tends to lean more to one side:

Example: Giraffes with the longest necks are able to reach more leaves to each. Selective pressures will work in the advantage of the longer neck giraffes and therefore the distribution of the trait within the population will shift towards the longer neck trait.

Disruptive Selection  

This type of natural selection occurs when selective pressures are working in favour of the two extremes and against the intermediate trait. This type of selection is not as common. When looking at a trait distribution, there are two higher peaks on both ends with a minimum in the middle as such:

Example: An area that has black, white and grey bunnies contains both black and white rocks. Both the traits for white and black will be favored by natural selection since they both prove useful for camouflage. The intermediate trait of grey does not prove as useful and therefore selective pressures act against the trait.

Explain how greenhouses modify the environment to improve growing
conditions for plants?

Answers

they modify by creating an acceptable environment, and condition for plants

Use the following questions to write your conclusion to your lab report.

What did you learn from doing this lab? (Did the volcano have an effect on the ability of a predator to catch their prey? What might this mean for future generations? Include numbers from your data tables to show these changes.)



How could you make the lab better?

Answers

Answer:

WHat??

Explanation:

1. Describe the shape of a DNA molecule.​

Answers

Answer:

Explanation:

If you think of the double helix structure as a ladder, the phosphate and sugar molecules would be the sides, while the bases would be the rungs.

Answer:If you think of the double helix structure as a ladder, the phosphate and sugar molecules would be the sides, while the bases would be the rungs.

A doctor is diagnosing a patient with gigantism. Which of the following sources would be the least helpful in making
that diagnosis?
O growth chart
medical book
patient's family history
O patient's diet

Answers

Answer:

The answer is D, patient's diet.

Explanation:

As per the observation, it is clear that the correct answer is a medical book as it will have the medical history of the patient.

Gigantism is an extreme situation this is almost usually due to an adenoma, a tumor of the pituitary gland. Gigantism happens in sufferers who had immoderate boom hormones in childhood. The pituitary tumor cells secrete an excessive amount of boom hormone (GH), which main to many adjustments withinside the body.

How is gigantism diagnosed?

If gigantism is suspected, the prognosis is commonly shown via way of means of taking blood assessments to degree the stages of boom hormone and insulin-like boom component 1 (IGF1) circulating withinside the blood. IGF1 is launched into the blood often via way of means of the liver in reaction to boom hormone.

Thus it is clear that medical books will have a medical history of patetint wityh gigantism.

To learn more about gigantism refer to the link :

https://brainly.com/question/7035609

What are the differences between the Arctic and
Antarctic Regions *

Answers

Answer:

The primary difference between the Arctic and Antarctica is geographical. The Arctic is an ocean, covered by a thin layer of perennial sea ice and surrounded by land. ... Antarctica, on the other hand, is a continent, covered by a very thick ice cap and surrounded by a rim of sea ice and the Southern Ocean.

Explanation:

1. When a consumer eats a producer, 10 percent of the producer's energy is passed on to the consumer trophic level. What happens to the other 90 percent?

A. It is added back to the soil by decomposers.


B. It is used by the producer to pass on to the next trophic level.

C. It is used for cell processes or released as heat.

D. It is consumed and used by the consumer.

2. Why is there less biomass at the top of the energy pyramid?
A. Secondary and tertiary consumers have to consume a lot more food to support themselves, so there are fewer of them.

B. Secondary and tertiary consumers live longer, so there are fewer of them because they reproduce more slowly.

C. Secondary and tertiary consumers are larger, so there are fewer of them.

D. Secondary and tertiary consumers have bigger ranges, so there are fewer of them because they each need a lot of space.

3. Using the ten percent rule, determine how many kilocalories of energy the tertiary consumer tuna will receive.

Algae: 135,000 Kcal
Shrimp: _
Lantern Fish: _
Tuna: _

A. 135 Kcal

B. 1,350 Kcal

C. 135,000 Kcal

D. 13,500 Kcal

4. Read the following statements about various species of plants and animals. Which one would be classified as an invasive species?

A. Kudzu, a plant from Japan, was introduced as a foliage crop and to reduce soil erosion. It grows up to a foot per day, smothering low-growing plants and killing trees.

B. Dandelions are plants from Eurasia. They are often considered weeds by homeowners and killed off by using herbicide. They can be consumed in salads or as tea and are the first food resource for bees in the spring.

C. Honey bees are from Europe and can sting people. They are often farmed in America for their ability to pollinate and provide honey.

D. Loosestrife beetles, native to Eurasia, have been released in various American states to combat the invasive plant, purple loosestrife.

5. Using the following formula to find the efficiency of energy transfer between the harbor seal (2,500 Kcal) and a polar bear (375 Kcal)
(Energy level transferred to next level) / (Total energy input) × 100

A. 15%

B. 20%

C. 10%

D. 12%

Thank you so much if you answer this:) I'm working on it and will probably figure them out but a little help would be appreciated. <3​

Answers

Answer: I just to happen to be working on this quiz right now. I got 5/5 on it, so I hope this helps :D

~Ten Percent Rule Quick Check~

1. B) It is used for cell processes...

2. D) Secondary and tertiary consumers have to consume a lot more..

3. D) 135 Kcal

4. C) Kudzu, a plant from Japan...

5. A) 15%

^This is confirmed valid as of January 17th, 2022^

Consumers are the organisms that depend on others for food and energy for the metabolic process while the producers produce their food at the trophic levels.

The correct options are 1. C, 2. A, 3. A, 4. A and 5. A.

The trophic levels can be explained as:

1. In the trophic levels the energy gets decreased as it passes from one level to another because it is used in the cellular process it is released in the form of heat.

2. Secondary and tertiary consumers have to feed a lot and hence, they are fewer in number compared to the producers. They maintain the population and balance out the producer and consumer ratio.

3. According to the 10 % rule of energy transfer, the Tuna will receive 135 Kcal of energy because the energy decrease by 10% as one moves from the lower trophic to the upper levels.

4. The species that are non-native to a place or region are called invasive species hence, the Kudzu plant is the invasive species as it is introduced from Japan.

5. Given,

Energy of Seal = 2,500 Kcal

The energy of polar bear = 375 Kcal

The 10% of 2500 will be 250 and the 5 % 125 thus, 15% is the efficiency.

Therefore, the correct options are 1. C, 2. A, 3. A, 4. A and 5. A.

Learn more about energy transfer and trophic level here:

https://brainly.com/question/20586850

Which list the layers of the atmosphere from earth surface outward?

Answers

Answer:

In order from earth to space it would be troposphere, stratosphere, Mesosphere, Thermosphere, exosphere (ionosphere.)

Explanation:

^

troposphere, stratosphere, mesosphere, thermosphere

What are some treatments for cancer? Select all choices that apply.
A. removal by surgery
B. treatment with high-energy radiation
C. treatment with chemical compounds
D. removal by cyclins

Answers

Answer:

I know its A and B but I'm not sure if there are other treatments besides those two

Explanation:

Removal by surger and  treatment with high-energy radiation.

What is treatment of cancer?

Cancer is a condition when a few of the body's cells grow out of control and spread to other bodily regions.

In the millions of cells that make up the human body, cancer can develop practically anywhere. Human cells often divide (via a process known as cell growth and multiplication) to create new cells as the body requires them.

Occasionally, this systematic process fails, causing damaged or aberrant cells to proliferate when they shouldn't. Tumors, which are tissue masses, can develop from these cells. Tumors may or may not be cancerous.

Therefore, Removal by surger and  treatment with high-energy radiation.

To learn more about cancer, refer to the link:

https://brainly.com/question/8590464

#SPJ2

The primary source of energy in most ecosystems is/are

Answers

Answer:

The Sun.

Explanation:

Energy reaches the Earth in the form of electromagnetic radiation.

Terrestrial solar radiation means solar radiation that reaches the Earth after passing through the Earth's atmosphere. About 97% of solar radiation reaches the Earth in the range of wavelengths 0.29 - 2.5 μm, and about 3% with wavelengths greater than 2.5 μm.

Which of the following could result if meiosis did not occur in the process of sexual reproduction?

Answers

What would happen if meiosis did not occur in sexually reproducing organisms? The chromosome number would double in each generation because the process of meiosis halves the number of chromosomes in the gametes. ... the exchange of genetic material between homologous chromosomes that results in recombinant chromosomes.

Hope this helps a bit

A environmental scientist buys 20 gallons of oil eating bacteria to help remediate an area affected by an oil spill. The volume of water the scientist wants to cover with this bacteria is 5 ft³. What volume of water can the scientist cover with the bacteria she purchased? (1 gal = 0.13 ft³)

Answers

Answer:

2.6  [tex]ft^3[/tex]

Explanation:

Using the conversion factor:

1 gallon = 0.13 [tex]ft^3[/tex]

Therefore,

20 gallons = 20 x 0.13

       = 2.6‬  [tex]ft^3[/tex]

This means that only 2.6  [tex]ft^3[/tex] out of the 5  [tex]ft^3[/tex] total volume of water the scientist wants to cover can actually be covered by the bacteria that was purchased.  

Help (will give crown for answer)

Answers

Answer:genes

Explanation:

How is energy released from ATP?

Answers

Answer:

food zygote d9gugousfoysocysohcoecu sperm

Answer:

In a process called cellular respiration, chemical energy in food is converted into chemical energy that the cell can use, and stores it in molecules of ATP. ... When the cell needs energy to do work, ATP loses its 3rd phosphate group, releasing energy stored in the bond that the cell can use to do work.

Use the word “capacity”in a sentence.

Answers

Answer:

The weight capacity in this elevator is over its limit, somebody is gonna have to  step out

Bromine is a liquid at room temperature. The volume of a sample of bromine is measured in a 50 ml beaker and a 100 ml beaker. How will the two
measurements compare?
A. The volume of bromine will be larger in the 100ml beaker.
B. The volume of bromine will be smaller in the 50ml beaker,
C. The volumes will be the same.
D. Both A and B

Answers

I think it’s D bye have a nice day

The actual volume of bromine in each beaker will be same only the difference in height will be comparable. Therefore, option (C) is correct.

What are the properties of liquid ?

A liquid's attributes are;

1) Compared to the volume occupied by a gas, the volume of a liquid is relatively stable at conditions that allow it to remain in the liquid state.

2) A liquid will take the form of the container it is placed in.

3) A liquid's surface in a container must be flat for the attraction forces between its molecules to be in equilibrium both at the liquid's surface and within its body.

Therefore, there will be variations in the measured height of the same volume of bromine in each beaker given that the volume of the bromine is measured in a 50 ml beaker and a 100 ml beaker.

Learn more about Liquids, here:

https://brainly.com/question/13279941

#SPJ5

Other Questions
9) Write an equation of the line that passes through the point (4, 5) with slope 2.A. y4=2(x+5)B. y4=2(x+5)C. y+5=2(x4)D. y+5=2(x4) How many moons are in our solar system? It took Ciera 24 minutes to drive 18 miles. It took chains of one hour to drive 46 miles. Who is driving at a faster rate? HELP PLEASEEEEEEEEEEEEEEE need help asap please !! Good morning everyone! I have a tricky math question here, and was wondering if any of you can solve it. Have a great day! :D Can somebody please help me with this.! Which nutrient cycle has no Gas Phase? Brian has 98. Colin takes y. How much is left? Which of the following could result if meiosis did not occur in the process of sexual reproduction? What is the value of the expression Can someone please help me on these? The front wings, which are tough, protect the rear wings.A. simpleB. compoundC. complex Which of these is an example of European imperialism in Africa?A) Africa is rich in natural resources such as gold, diamonds, and oilB) Large plantations in the Americas created a demand for enslaved peopleC) European leaders staked out their claims in Africa during the Berlin ConferenceD) Advancements in technology and navigation allowed Europeans to more easily explore Africa Pls help and show workings Due ASAP Which is NOT a role of political parties?A. Educating the public about important issuesB. Acting as institutional watchdogC. Facilitating compromise and coordination in governmentD. Drafting bills for Congressional consideration please answer these for me Suppose y varies directly with x. Write a direct variation equation that relates x and y when y = 6 and x = 12 Write and solve a system of linear equations that represent the situation. There are a total of 64 students in two clubs: xylophone and yo-yo. The xylophone club has 10 more members than the yo-yo club. How many members are in the xylophone club? How many members are in the yo-yo club? The order to put this in