Please which one is the right answer

Please Which One Is The Right Answer

Answers

Answer 1

Answer:

a

Explanation:

maby

Answer 2

Answer:

The last one is the answer so you are correct.

Explanation:


Related Questions

Romeo and Juliet Act 5. I will give brainliest

What is your first reaction to the S u i c i d e s of Romeo and Juliet? Do they act nobly or cowardly in choosing S u i c i d e Consider other actions they might have chosen? Do you think Shakespeare glorifies or condemns S u i c i d e in the play? Write your opinion and support it with details from the play.

Answers

Answer:

I think it's very noble that they chose to give their lives for what they thought was right.

Explanation:

Please mark brainliest

Answer:

In the play Romeo and Juliet they choose S u i c i d e

They acted very cowardly.

 Both had a life ahead of them and they desided to do S u i c i d e

a friend of Romeo’s, brings him news that Juliet is d e a d and lies in the Capulet tomb. Resolved to find her and join her in death, Romeo first visits an apothecary and bribes him to obtain an i l l e g a l (and l e t a l) p o i s o n.

Explanation:

make a list of major professions followed in nepal​

Answers

Answer:

tourism, carpets, textiles; small rice, jute, sugar, and oilseed mills; cigarettes, cement and brick production

Explanation:

What statement best to characterize the pilgrims early view of the Native Americans? (ILL GIVE BRAINIEST)

Answers

Answer:

the first one is correct

Answer:

savage barbarians was right, but towards the middle of the time they spent there with the indians, the second was true

you are correct though

Explanation:

What is Old Major’s solution to the animals’ misery? Animal Farm Chapter 1.

Answers

Old Major's instruction is given in chapter one during the meeting in the old barn. All the animals have assembled to hear what he has to stay. The key point of his directive is that the animals should rise up against Man and be rid of him forever.

plz help i need to get to a 90

Answers

Answer: pun

Explanation:

The correct answer for the question would be “pun”

Which of the following words best fits into the sentence below in ancient freeze pilgrims would flock to Athens in order to_____ the goddess Athena in her temple PLEASE HELP!

Answers

Answer:

where is the option?

Explanation:

Answer:

Venerate "to give great respect."

Explanation:

Read the following passage from a personal narrative:
Dad must hate it when his clients ask about the family.
"'And what about Rob Junior? Following in Dad's
footsteps?" Sometimes I think it might almost be worth it
to go to law school - not to pursue a career in law but just
to escape Dad's judgmental stares and disappointed sighs.
Which is the most accurate analysis of the two topics in this story?
O A. The speaker admires his father but finds hope for the future by
following his own calling.
OB. The pressure the speaker feels to further his education creates
tension in his home.
O C. The family supports one another in hard times, but the speaker
feels smothered.
OD. The speaker's sense of responsibility prevents him from pursuing
his dream.

Answers

Answer: B, The pressure the speaker feels to further his education creates tension in his home.

Explanation:

The speaker says he is considering to go to law school, not to further his education, but just to stop his dad from criticizing him. This shows that he does not hope to follow his own calling (a) and it never referred to the family supporting each other (c) and he is not doing it to be responsible, just to avoid his dad's criticism.

The most accurate analysis of the two topics in this story is that the pressure the speaker feels to further his education creates tension in his home, which is in option B. The passage suggests that the speaker feels pressure from his father to follow in his footsteps and become a lawyer.

What is a personal narrative?

The passage from the personal narrative describes the tension and pressure that the speaker feels in relation to his father's expectations for his future career path. The speaker indicates that his father's clients often ask about him and whether he plans to follow in his father's footsteps as a lawyer. The speaker also implies that his father expects him to do so, as evidenced by his judgmental stares and disappointed sighs when the speaker expresses disinterest in law.

Hence, the most accurate analysis of the two topics in this story is that the pressure the speaker feels to further his education creates tension in his home, which is option B.

Learn more about the personal narrative here.

https://brainly.com/question/1458673

#SPJ7

NEED HELP ASAP!!!!!! SOURCE 1: Psychologists worry that kids who spend too much time using virtual reality (VR) programs may lose their ability to tell the real from the imaginary. VR experiences can be so compelling that very young children may start to learn lessons about how to behave that do not apply to the real world. SOURCE 2: Virtual reality allows people to put themselves in others shoes in a more realistic way than ever before. In recent experiments, children who were given empathy training using VR showed higher levels of kindness and understanding than their peers because they felt they had truly experienced the suffering of others.


Which statement best synthesizes information from both sources?​

Answers

Answer:D

I took the Exam

Explanation:

Answer:

C

Explanation: I took the exam

Q-3- Write sentence of the following words: h.w
a-ancient ....
b-limits...
c-obviously....​

Answers

a. Ancient: as an adjective, it relates to a remote period of time. As a noun, it refers to an aged person or a person that lived in ancient times. Here's a sentence with this word:

“Ancient Greece history is long, yet very interesting.”

b. Limits: a limit is “a point or level beyond which something does not or may not extend or pass.”

“Thanks to the system of Checks and Balances, all three branches of the government has limits to their power”

c. Obviously is an adverb meaning “clearly.”

“I was obviously uncomfortable with all that noise”

Which command is punctuated correctly?
Please don't touch the orchids.
Please don't touch the orchids!
Please don't touch theorchids?

Answers

Please don’t touch the orchids!

Answer:

please don't touch the orchids.

How can the topic "students and cell phones” be presented as an argument?

Recent surveys suggest that over 70 percent of all American students ages 14–17 own a cell phone.
Students at Omega High School have expressed interest in having access to their phones during school hours.
School policies regarding cell-phone usage varies by region and is the source of considerable debate.
Cell-phone usage should be embraced at public schools as a means of information acquisition.

Answers

I believe it would be D because the rest of the statements are information that would support the argument which in this cause is the last statement.
it does not consider the debate of region cell phone usage is source of nothing

is the term 'carpe diem' still relevant in today's culture? If so, where? Do you see it in current music, movies, etc?

Answers

Answer: See explanation

Explanation:

Carpe Diem is a Latin word that simply means that on should enjoy or sieze the moment. The word denotes that one should think less about what'll happen in the future but rather enjoy the moment presently.

It's still relevant in today's lecture. Recently, a musician named Olamide had an album titled "Carpe Diem". Also, there was a movie released that was tilted Carpe Diem as well. Both depicts that people should enjoy their lives and live their best moments.

Title: Persuasive Writing

1. An argument involves taking a position on a topic and supporting your position with strong reasons.
What (argument) could you make about the length of the school day?

Answers

Are you opposing or agreeing with the questions?
are u agreeing with the question??

(1) Roller derby is a high contact extreme sport that began in the United States during the 1920s. (2) This sport takes place on a long oval track. (3) Participants earn points by skating past, or "lapping," members of the other team. (4) Roller derby is primarily played by women, and most skaters are amateurs who raise their own support in order to participate. (5) Many skaters wear fun costumes and adopt fake names to express their personalities. (6) Because many injuries can occur at roller derbies, emergency medical personnel are required to stay rinkside, and skaters must wear protective gear at all times.

Which of the following is an example of a compound-complex sentence?
A.
sentence 6
B.
sentence 5
C.
sentence 3
D.
sentence 1

Answers

Answer:

The option that is an example of a compound-complex sentence is:

A.  sentence 6

Explanation:

A compound-complex sentence is formed by two independent clauses and a dependent one, at least. In sentence 6, the two independent clauses are the following:

1. emergency medical personnel are required to stay rinkside,

2. and skaters must wear protective gear at all times.

Notice that the clauses above are capable of expressing a complete thought even if they stand alone. That is what makes them independent. The second clause begins with a coordinating conjunction (and), which is used to connect independent clauses.

Also in sentence 6, we have a dependent clause:

3. Because many injuries can occur at roller derbies,

The clause above, if read alone, would not make sense. The subordinating conjunction (because) shows that more information is necessary for the clause to express a full thought.

As we can see, sentence 6 is a compound-complex sentence.

FIRST PERSON TO ANSWER GETS BRAINLY AND 50 POINTS (a suprise question >:))

Answers

Answer:

ok

Explanation:

Answer:

2-1=1

Explanation:

hewwo humans im juice wrld

Answers

Answer:

HELLO :)))))))

Explanation:

Answer:

Ok

Explanation:

Sing lucid dreams

What is perspective about slavery, and does it still affect African-Americans in today's society? This is for English class.

Answers

Answer:

I think slavery was bad and should have never happened. It doesn't affect them anymore but they still go through racism and are still trying to find social justice.

Explanation:

- Explain how you and your teachers are trying hard to let your learning go smooth?

Answers

Answer:

plz mark it brainlist

Explanation:

me and my teachers are trying very hard to let us study in this pandemic we woke up early at 8 o'clock . our teacher makes our class interesting by adding the activities so we enjoy the classes our teachers are going to school they are preparing board they are assigning our tasks.

hope it helped

Answer:

The teachers that I am currently having for my virtual school, are always trying to make things go as smoothly and stress free as possible. But still keeping it all school and education related.

They check-in on the class daily. Making sure that we take care of our mental health before anything and everything. At times, when a teacher notices something is off about a student, they will then proceed to send a private email asking to see if they're alright.

With everything going on, they also try to keep the classes in a light-hearted mood. They crack jokes once in awhile and try their absolute to keep a smile on their students faces. Sometimes they'll even evaluate the day and tell us that we did a lot, and that we would have no homework due for tomorrow.

Just like everyone, teachers are also human. But unlike many, teachers try everyday to give their full effort to educate and create a friendly environment.

All just for their students.

SOMEONE PLEASEE HELP
50 POINTS!!!!

Answers

Answer:

im going to go with b

Explanation:

PLZZZ ANSWER QUICK !!

Read the excerpt from "Homesick."
I was looking up at a white cloud skittering across the sky when all at once someone tramped down hard on my right foot. Ian Forbes
Snarling bulldog face.
What does the figurative language in the excerpt tell readers about lan Forbes?
Olan is very unattractive
O He feels threatened by the narrator.
O lan is seeking attention.
O He wants to scare the narrator.

Answers

Answer:

he wants to scare the narrator

Explanation:

The figurative language the readers about lan Forbes is :

D) He wants to scare the narrator.

"Homesick"

The figurative language the readers about lan Forbes is that he wants to scare the narrator.

Figurative language is a way of communicating oneself that does not utilize a word's strict or practical meaning.

Common in comparisons and embellishments, it's as a rule utilized to include imaginative thrive to composed or talked dialect or clarify a complicated idea.

Thus, the correct answer is D.

Learn more about "Homesick":

https://brainly.com/question/2400770?referrer=searchResults

Follow my IĞ ill give you kìşşy and answer this for sum points​

Answers

Answer:

Toes

Explanation:

Fingies

Come to find out that my homeboy hit her up (whoa, whoa, whoa)
All this ice, I need a freezer, mhm
Whip it up, egg beater, mhm
Whipping up two-seaters
Said she love me, don't believe her, mhm

Answers

Answer:

EgG

Explanation:

All this ice, I need a freezer, mhm

Whip it up, egg beater, mhm

Whipping up two-seaters

Said she love me, don't believe her, mhm

Can't be mediocre, mhm

Twenty on her choker, mhm

Fv,ck her, I don't know her, yeah

Give me face, like poker

Whoa, can't believe I wanted you

Whoa, I can't believe I wanted you, yeah

Girl, I can't believe I wanted you

Girl, I can't believe I wanted you

Give me face, like poker

Whoa, can't believe I wanted you

Whoa, I can't believe I wanted you, yeah

Girl, I can't believe I wanted you

Girl, I can't believe I wanted you

Twenty on her choker, mhm

Fv,ck her, I don't know her, yeah

Give me face, like poker

Whoa, can't believe I wanted you

Whoa, I can't believe I wanted you, yeah

Girl, I can't believe I wanted you

Girl, I can't believe I wanted you

i need help from somebody who takes debate class at school, please
let me know if you do

Answers

I can help, just message me and I’ll try my best

What are the signal words used in problem and solution? *

Answers

problem. answer. so that. solution. solved.

Mr. Kershner is a school nurse. He uses, on average, 24 self-adhesive bandages during each spring month: March, April, and May. He also knows that in June there are several field days and he will need 4 times the number of bandages for that month.

Answers

Answer:

in spring month = 24 self adhesive bandages

IN june = 4 X 24

= 96 self adhesive bandages

hence, he will need 96 self adhesive bandages for that month

Answer:

168 is the answer :)

Explanation:

10 pts.+brainliest

Identify the infinitive in the sentence: "The dog started to wag his tail as I handed the bone to him."
A. The dog
B. to wag
C. as I handed him the bone
D. to him

Answers

Answer:

B

Explanation:

An infinitive is the basic form of a verb, with no inflection. The correct answer would be B, because "wag" is not inflected in any way.

which of these can help you comprehend what you're reading ?

Answers

Letter A is the answer

Write one paragraph!!!!!reasons why the minimum wage should be decreased?

Answers

Answer:

Lowering the minimum wage may then produce opportunities for teens and the unskilled. This helps them to get necessary work experience and spur the economy to hire even more people. When enough workers are actually in the workforce, similar to the year 2000. This demand will cause a justified increase in market wages.

Explanation:

I go ogled different effects this is what it  said somewhat, i put it in my own words!:)

Hope you get a good grade now!:)

How does Petruchio leave the wedding feast? What reason does he give for leaving in his monologue (III.ii.228-246)?

Answers

He announced that he will leave, skipping the traditional wedding feast that has been arranged.

29 POINTS HURRYYYYYY UPPPPPPPPP
BRAINLY

NAME 2 PEPLE IN ANIMAL FARM

Answers

Answer:

Benjamin and bluebell

Explanation:

please mark me as brainliest

Other Questions
3. Study the changes in population graph, what % lived in cities by the 1930's?By the 1970's? What led the people of France to agree to an imperial dictatorship instead of a true democratic republic like the one selected in the American colonies? why human are not responsible for global warming? Which of the following cells can generate ATP through glycolysis? A. Eukaryotic Cells (Plants and Animals) B. Prokaryotic Cells (Bacteria) C. None of the above D. All of the above What is the length of EF in the right triangle below? Choose one of the three themes (social oppression, greed, or good vs. Evil) and explain something you know about it in the real world OR explain where else you have seen the theme (a book, movie, show, etc.) Please help quick What is f(2) if f(x) = 2x-5 and f(4) if f(x) = -3x + 15step by step please! Solve.Okay here is 20 letters brainy Please help with this What is public participation? Why is itnecessary for environmental conservation AUUUAACUGUUCUGUCUAGAG1. Construct an Explanation Based only on the information provided, why could themRNA section be translated into three different sets of amino acids, instead of just oneset?2. Use Models Use the genetic code to translate the sequence into each of the threepossible sets of amino acids.3. Draw Conclusions Which of the three sets of amino acids is the most likely to beincluded in the polypeptide? Explain your reasoning. Please help me with this homework Different cities have different sales tax rates. Here are the sales tax charges on the same items in two different cities.Complete the tables. 50 points brainliest I'm watching to wait explain the difference between essential body fat and storage body fat which is true about the subject matter of an ode?a. it is usually a well-known object such as a monumentb. it varies greatly from famous people to ordinary objectsc. it is often something imaginary or mythicald. it tends to focus on an explored exotic places Find the amount of sales tax if the sales tax rate is 5% and the cost of the winter coat is $40. Hint: this question is only asking for the sales tax. I dont get- this thing .-. b.10 ftC3 ftarea of the rectangle =area of the triangle = In "House of the Scorpion", why can't they harvest El Patron's body? (plz quickly help meh due tomorrow) Ill mark you a branilyst if you answer this question