Pollen is collected by honeybees and carried ……….


a.
on their hind legs


b.
on their antennae


c.
in their mouths


d.
under plates on their abdomen

Answers

Answer 1

Answer:

a.  on their hind legs

Explanation:

Hope this helped!

Answer 2
A on their hind legs

Related Questions

How do I respond to “that's what I'm saying!” Help please!!!

Answers

Answer:

Okay, i understand.

Explanation:

I think you can respond with something like that.

Answer:

say sum like- honestly! or omg we have so much in common

Explanation:

hope this helps! xo

Simone worked hard at studying. She makes A's now.

Which is the best way to combine these two sentences?
A.
Simone worked hard at studying she makes A's now.
B.
Simone working hard at studying and makes A's now.
C.
Simone worked hard at studying, and she makes A's now.
D.
Since Simone worked hard at studying and making A's now.

Answers

Answer:

C.    Simone worked hard at studying, and she makes A's now.

Explanation:

"Don't worry, it ain't loaded."
1. Who said it?
2. Where was it said?
3. What "situation" is he explaining?
outsiders

Answers

Dally, in Dairy Queen, he started to Cary a heater because all over town there was warfare, Soc against greaser.

The given statement was said by Dally, in Dairy Queen. This statement was used to explain the situation in which he started to carry a heater because all over town there was warfare, Soc against greaser.

What is a heater?

A heater or heaters a device that generates and radiates heat, usually to increase the temperature of a space or construction. Because both natural gas and propane are smokeless fuels, if the gas heater is smoking, something else is burning.

When a heater has been inactive for a while, dust or other debris that has accumulated on the burner is usually to blame. If the heater is emitting a musty odor or the smell of burning dust, nothing is likely amiss.

These odors typically result from dust accumulation inside the unit, dampness inside, or debris stuck in the filter. If one wants to swiftly warm a space, radiant heaters are the finest option.

Learn more about heater from here:

https://brainly.com/question/9881873

#SPJ2

The story "The Veldt" by Ray Bradbury takes place in a futuristic setting where technology does just about everything for families. The children in
this story, Wendy and Peter, have a room called the nursery which is made up of five wall-sized TV screens which cover each wall and the ceiling
Every part of the room is there to make your experience inside it feel as realistic as possible. Their parents, George and Lydia, are growing more
and more concerned that their children seem to be fixated with visiting an African veldt in the nursery. Every time they go in, they see them in
the hot, dry air Watching lions feast on their prey in the background. Eventually, their parents become so concerned that they lock up the
nursery. Peter in response makes vague threats toward his father. After this, George invites over his friend, David, who is a psychologist to get
his perspective on the situation. George and David find that the children have broken into the nursery and are sitting in the African veldt again.
After analyzing the scene left in the nursery, David recommends that George shut the house off entirely. The children throw a hysterical tantrum
at having the house shut off and scream that they wish their parents were dead. Eventually their hysterics are enough to convince their parents
to let them in the nursery one last time before they leave on a vacation and shut the house off for good. When David returns to take the family
to their vacation, he finds only the children in the nursery.
Which evidence best supports the theme that relying too heavily on technology can be a bad thing?
O "I feel like I don't belong here. This house is wife and mother now, and nursemaid. Can I compete with an African velde? Can I give a bath
and scrub the children as efficiently or quickly as the automatic scrub bath can? I cannot" (Bradbury 4).
O "They were awfully young, Wendy and Peter, for death thoughts" (Bradbury 5).
O "And although their bed tried very hard, the two adults couldn't be rocked to sleep for another hour" (Bradbury 8).
O "This house which clothed and fed and rocked them to sleep and played and sang as was good to them" (Bradbury 2).
O "A psychologist never saw a fact in his life. He only hears about feelings, vague things" (Bradbury 10).

Answers

Answer:

O "This house which clothed and fed and rocked them to sleep and played and sang as was good to them" (Bradbury 2).

Explanation:

Select two quotes from passage 2 that develop the idea that the current generation has a duty to protect freedom for all citizens of the country.

Answers

Answer: a and c

Explanation:

The two quotes that develops the idea is  "...to make these words, these rights, these values of life and liberty and the pursuit of happiness real for every American." and "They are the words of citizens, and they represent our greatest hope."  Thus, option (A) and (D) are correct.

What is freedom?

Freedom is characterized as the condition of being unrestricted, autonomous, and free from imprisonment. For example:- A prison free from the jail.

The two quotations that support the thesis that the current generation has a responsibility to uphold freedom for all Americans are "...to make these words, these rights, and these principles of life, liberty.

The pursuit of happiness real for every American." "They are the words of citizens, and they stand for our greatest hope," is another phrase.

Therefore, it can be concluded that option (A) and (D) are correct.

Learn more about freedom here:

https://brainly.com/question/4077647

#SPJ6

Your question is incomplete, but most probably the full question was….

List of options:-

a. "...to make these words, these rights, these values of life and liberty and the pursuit of happiness real for every American."

b. "We must act, knowing that our work will be imperfect."

c. "My oath is not so different from the pledge we all make to the flag that waves above and fills our hearts with pride."

d. "They are the words of citizens, and they represent our greatest hope."

e. "...not only with the votes we cast, but with the voices we lift in defense of our most ancient values and enduring ideals."

5)Complete these sentence halves using your own words. You should use a to-infinitive in
each one

a)He arrived too late ...

d)Your brother has gone...

b)Do you understand where ...?

e)I'd like you....

c)The students need a library...

English ain't my thing for real​

Answers

a) to give his wife the flowers.

d) to work.

b) to go?

e) to remain humble.

c) card to check out books.

Which three lines in this excerpt from Anita Desais "Games at Twilight" clearly show an omniscient narrator?
They faced the afternoon. It was too hot. Too bright. The white wals of the veranda glared stridently in the sun. The bougainvillea hung aboutit.
purple and magenta. in livid balioons. The garden outside was like a tray made of beaten brass, flattened out on the red gravel and the stony
soil in all shades of metal-aluminum, tin, copper, and brass. No life stirred at this arid time of day-the birds stil drooped, like dead fruit. in the
papery tents of the trees: some squirrels lay limp on the wet earth under the garden tap. The outdoor dog lay stretched as if dead on the
veranda mat. his paws and ears and tail all reaching out like dying travelers in search of water. He rolled his eyes at the children-two white
marbles rolling in the purple sockets, begging for sympathyand attempted to lift his tail in a wag but could not. It only twitched and lay still.
Then. perhaps roused by the shrieks of the children, a band of parrots suddenly fell out of the eucalyptus tree, tumbled franticaly in the still.
sizzling air, then sorted themselves out into battle formation and streaked away across the white sky.
The children, too, felt released. They too began tumbling, shoving. pushing against each other, frantic to start. Start what? Start their business.
The business of the children's day which is-play.

Answers

The lines that show an omniscient narrator are: “The garden outside was like a tray made of beaten brass, flattened out on the red gravel and the stony soil in all shades of metal—aluminum, tin, copper, and brass.”

Who is an Omniscient Narrator?

This refers to a person that makes narration with the all-knowing and all-seeing knowledge as he knows the thoughts, feelings, and actions of characters in a story.

From the complete text, there is the narration that shows the use of an omniscient narrator which shows the description of the garden outside and surrounding environment.

Read more about omniscient narration here:

https://brainly.com/question/928756

#SPJ1

Maya Angelou was a mother and grandmother. Maya Angelou was one of the nation's preeminent literary figures.
What is the best way to combine the information in the two sentences?
A.
Maya Angelou, one of the nation's preeminent literary figures, was a mother and a grandmother.
B.
Maya Angelou was a mother and grandmother of one of the nation's preeminent literary figures.
C.
Maya Angelou was one of the nation's preeminent mothers and grandmothers.
D.
Maya Angelou was a mother, grandmother, was one of the nation's preeminent literary figures.

Answers

Answer:

A. Maya Angelou, one of the nation's preeminent literary figures, was a mother and a grandmother.

Explanation:

"Maya Angelou was a mother and grandmother. Maya Angelou was one of the nation's preeminent literary figures."

The best way to combine the information in the two sentences is option A.

This is because, unlike the other options, option A kept the meaning of the combined sentences without distorting or making it ambiguous.

Combining the two sentences show that Maya Angelou was prominent, as well as a mother and grandmother.

Answer:

a

Explanation:

Our new doghouse is so fancy, even Smokey himself will not step inside!

Read the sentence.

Why does the author use the word “himself” after Smokey?

to change the meaning of the sentence
to give emphasis to the meaning of the sentence
to give humor to the meaning of the sentence
to change the way the sentence is read

Answers

Answer:

to give emphasis to the meaning of the sentence

Explanation:

Answer: B

Explanation:

Got it right

Which lists the correct bibliographical order and format, based on the standard taught in this unit.
And Now Miguel. Joseph Krumgold. 2007. Crowell: New York.
Krumgold, Joseph. And Now Miguel. New York: Crowell, 2007.
And Now Miguel. Joseph Krumgold. 2007: New York, Crowell.
Krumgold, Joseph. And Now Miguel. Crowell: New York, 2007.

Answers

Krumgold, Joseph. And Now Miguel. New York: Crowell, 2007.

Explanation:

If you look at notes you've taken you will find the format you need to use to write these things.

Answer:

Krumgold, Joseph. And Now Miguel. New York: Crowell, 2007.

Explanation:

Sample entry:

Bulla, Clyde Robert. Squanto, Friend of the White Men. New York: Thomas Y. Crowell Co.,

1954.

Krumgold, Joseph. And Now Miguel. New York: Crowell, 2007.

When you have more than one source, arrange your entries in alphabetical order by the author's last name.

Sample entries:

Bulla, Clyde Robert. Squanto, Friend of the White Men. New York: Thomas Y. Crowell Co.,

1954.

Field, Rachel. Calico Bush. New York: Dell Publishing, 1931.

The girl said, ‘I did not attend the programme yesterday​

Answers

Answer:

Ooooooooohhh she didntt attenddd how sadd

Answer:

Ohhhhhhhh. She didn't attain the program Soo sad

Explanation:

Lol

why does jonas' father need to get to sleep early
GIVING BRAINLIEST​

Answers

To give Gabe good memories.
Answer: For better memory

the mayor wants to rename our city and i need to persuade him that my name is good

Answers

Give him facts and reason

Why do people tell fables to their children?
all of these reasons
to entertain them with animal stories
to share traditions of their culture
to teach them how to behave

Answers

Answer:

all of these reasons

Explanation:

where you think about it it's all

Answer:

all of these reasons

Explanation:

Hope this helps:]

Quilling is the art of using paper strips to create decorative patterns. The final product of quilling is attractive and can be used to decorate homes, offices, and other places. People also use quilling to make jewelry and stylish picture frames. One can use colored or white strips of paper for quilling. Some choose to use thick paper, while some prefer thin paper for quilling designs. People often use craft paper or construction paper for quilling. The beauty of this art is that it can be created using very simple tools. Quilling supplies are found in most arts and crafts stores. Although quilling is fairly simple, many people choose to take courses to learn the different techniques of quilling. Quilling will interest everyone.
8
Read the sentence from the passage.

Quilling will interest everyone.

How could the sentence be changed to better conclude the passage?
A.
Therefore, the art of quilling will interest those who want to use their artistic touch and make their surroundings more beautiful.
B.
Therefore, people must read articles about quilling to remain updated about new quilling techniques.
C.
In recent times, the art of quilling has become popular amongst artists, youngsters, and homemakers.
D.
In recent times, decorative objects made by quilling have become a popular choice among customers in gift shop

Answers

Answer:

A.

Therefore, the art of quilling will interest those who want to use their artistic touch and make their surroundings more beautiful.

Explanation:

I think the answer is A because its a wrap-up of everything written in the paragraph, which makes it a good conclusion. It summarizes what was in the paragraph while making a final point on quilling.

Whats the Answer to this please EXPLAIN your answers Giving Brainliest Lol:) XD lol

Answers

Answer:

Students should be free to choose there own cafeteria seats because it can weaken friendships

Explanation:

Help me please! Who is less skillful

Answers

the less skillful person is the amateur because they’re not actually meant to be skilled in whatever sport activity they’re in.

roast me in the comments

Answers

Answer:

Mirrors can't talk, lucky for you they can't laugh either <3

Answer:

i got u covered

Explanation:

You’re the reason God created the middle finger.

You’re a grey sprinkle on a rainbow cupcake.

If your brain was dynamite, there wouldn’t be enough to blow your hat off.

You are more disappointing than an unsalted pretzel.

Light travels faster than sound which is why you seemed bright until you spoke.

You have so many gaps in your teeth it looks like your tongue is in jail.

Your secrets are always safe with me. I never even listen when you tell me them.

I’ll never forget the first time we met. But I’ll keep trying.

I forgot the world revolves around you. My apologies, how silly of me.

I only take you everywhere I go just so I don’t have to kiss you goodbye.

Hold still. I’m trying to imagine you with personality.

Your face makes onions cry.

You look so pretty. Not at all gross, today.

I WILL DO BRAINLIEST!

3. What is emphasized in William Carlos Williams's "Landscape with the Fall of Icarus" but not in Pieter Brueghel's Landscape with the Fall of Icarus? What conclusions can you draw about the similarities and differences between the themes of the two works?

Answers

Answer:

William Carlos Williams emphasizes spring in “ Landscape with the Fall of Icarus”, but in PieterBrueghel’s Landscape with the Fall of Icarus, you can see that the person in front is wearinglong sleeves, which doesn’t emphasize spring.

Explanation:

I need help please !!!!!

Answers

It is A

plz what is your favoirte song by drake

Answer:

c

Explanation:

read this from frida hhhhhhhhhhhhhhhuuuuuuuuuurrrrrrrrrrrrrrrryyyyyy

she was in almost unbearable pain an agony that would persist for the rest of her life . in terrifying nightmares accident she relived the accident and heared the screams of the other victims .

the descriptive detail in this sentence show


A how kahlo looked

B what kabol to overcome
C what kahol became successful

Answers

Answer:C.

Explanation:

To show what Kahlo had to overcome.

Answer:

Your answer should be

What  Kahlo had to overcome.

Hope it helps!!!

4. Which passage from the excerpt most strongly suggests that Phineas is in
danger of having an accident?

Answers

Answer:A

Explanation:because I did the question already and I got it right

You would read the following with only a tone of seriousness:
During the 1957 World Series, Yankee catcher Yogi Berra noticed that Aaron grasped the bat the wrong way. "Turn it around," he said, "so you can see the trademark." But Hank kept his eye on the pitcher's mound; "Didn't come up here to read. Came up here to hit."


Please select the best answer from the choices provided

T
F

Answers

Answer:

False

Explanation:

Took the test on edge

During the 1957 World Series, Yankee catcher Yogi Berra noticed that Aaron grasped the bat the wrong way. "Turn it around," he said, "so you can see the trademark." But Hank kept his eye on the pitcher's mound; "Didn't come up here to read. Came up here to hit." This, statement is false. Thus, option (b) is correct.

What is happens in 1957 World Series?

The 1957 World Series pitted the American League's reigning champion New York Yankees against the National League's Milwaukee Braves. The Braves won the series in seven games, defeating the Yankees. The series aired from October 2 through October 10, 1957.

Throughout his judicial career, Oliver Wendell Holmes, nicknamed as "the Great Dissenter," was noted for his independence. It is believed that when Sherlock was in his eightieth year. During the 1957 World Series, Yankee catcher Yogi Berra spotted Aaron grasping the bat incorrectly.

As a result, the significance of the statement is false is the aforementioned. Therefore, option (b) is correct.

Learn more about on World Series, here:

https://brainly.com/question/30399116

#SPJ2

4. What do you think "her very shadow is blessed, and shall be blessed so long as
memory endures" means?

Answers

probably means her presence is very welcomed when she’s around, and that’s she’s a real positive person all the time. Also that she’d probably be remembered as a good person if she would die.

What is the preposition in this sentence.
The female chickens return and provide food for the little chicks.

Answers

Answer:

for

Explanation:

How is listening to the poem "Friendship" being read aloud different from reading it silently?




Reading the poem aloud reveals a rhythm that may not be apparent when the poem is read silently.


There is more emphasis placed on the word "friendship" when the poem is read aloud than when it's read silently.


Reading the poem aloud makes it easier to know where each stanza begins and ends.


Hearing each word enunciated correctly makes the humor of the poem more obvious and apparent.

Answers

Answer:

D

Explanation:

Answer:

Reading the poem aloud reveals a rhythm that may not be apparent when the poem is read silently.Explanation:

Hala missed class today because she’s not _____, even though she’s a _____ student.
Select one:

a.
well; well

b.
well; good

c.
goodly, wellish

d.
good; well

e.
good; good

Answers

It would be b because it makes a lot more sense

Answer:

b

Explanation:

well

good

What example of figurative langue is this line?

Wolf huffed and puffed and blew and blew
1.alliteration
2.irony
3.personification
4. onomatopoeia

Answers

This is personification because it is giving an animal, who normally has no character traits, actions and something to do

Answer:

the answer to your question is personification

When you are feeling down, what are 3 things you do to feel better? Write 3 paragraphs where you explain your strategies. Make sure to refrain from starting a sentence with "And", "But", and "Because

Answers

  One thing that I do that makes me feel better is that I draw when I am sad. This makes me feel better becuase Its what I love to do alll of the time and I also draw how I feel so people would understand how I feel.

The second thing I do to make me feel less down is sing. I sing my feelings and that helps me alot when I am down and I do many tequniques. .

The third thing I do is talk to someone and tell them how I feel. IT helps alot becuase many people do not know how u feel and if u talk to them they might know how to help you.

There are the three things that help me to be happy.

(------)_(-------)  /\           /\

Answer:

1. Listen to music

2. Sleep

3. Cook

Explanation:

When i am feeling down i often listen to music. Listening to music helps my calm down and think through what my next action is going to be so i don't do anything to rash. Funnily enough listening to song that are filled with rage often work best to calm me down. My theory on this is because it is nice to know that i'm not the only one that has strong feelings no matter what they are.

Sometimes when i am sad i will lay down and take a nap. When i am sad i find that sleeping helps my wake up and feel refreshed and then i can sort through my thoughts. Often times when i am sad it is because i have been up for to long with to much going on and i no longer have control over my own emotions.

Lastly if the first two techniques don't work I will cook. The actual act of cooking does nothing to make me feel better. My family says that when i'm angry or sad is when i cook best and so i cook for them when i am upset, and seeing their faces light up when i bring them food is what makes me feel better.

Which of the following is the best interpretation of the line: “The jar was gray and bare.” a. The jar is unimaginative. c. The jar is protected from the wilderness. b. The jar is in need of paint. d. The jar is technology.

Answers

Answer:

b. The jar is in need of paint.

Explanation:

The best interpretation of the line: “The jar was gray and bare.” is that the jar needs a paint job.

The line shows that the jar being gray means that it needs a color, because the cor gray is dull and being bare means its unappealing because there's nothing attractive about it.

Other Questions
Read the following passage.During the holidays, my mothers house glittered with decorations and hummed with preparations. We ate cookies and drank cider while we helped her wrap bright packages and trim the tree. We felt warm and excited, listening to Christmas carols and even singing along sometimes. We would tease each other about our terrible voices and then sing even louder. Which of the following best describes the point of view of this passage?Third Person Omniscient,Third Person Limited,First Person,Second Person Which of these sentences is the best definition of "verb tense"?where things happenwhy things happenwhat happens to a characterwhen things happen what is 5 1/3 as an improper fraction?? Solve for x.And please show me how u got the answer 9124x - 2)3x + 2 Comparing FunctionsHow much money will Bob in December have if his bank account growth stays at the same rate?Month Bank-Acc |January | $5,000February $6,700March $8,400April $10,100May $11,800 Which country closed its ports to farmers?A. SpainB. FranceC. England Can you help me plz? Write an equation in point-slope form for the line through the given point with the given slope(8,-3);m= -1/4 a drum has a diameter of 18 in and is 16 in deep find the volume What is the special rule with multiplying or dividing an equality by a negative number? (Im in a rush to get this answered,Im taking a test) What was one effect of the State Colonization Law of 1825?A. Mexico gained its independence from Spain.B. San Antonios population reached 20,000.C. Slavery was banned in Texas.D. The Old Three Hundred were recruited to settle Texas. please help me I don't answer this I'll give brilliance What is the graph of the linear function that is represented by the equation y= 1/2x-2 25 POINTS AND BRAINLIEST!! Clay wants to ride a Ferris wheel that has a radius of 80 feet and is suspended 9 feet above the ground. The wheel makes 6 revolutions in one minute. Find the period and amplitude. Read the following excerpt from "Woman Who Helped Hide Anne Frank Dies at 100" by Teri Schultz.Ms. MIEP GIES: I, myself, I'm just a very common person. I simply had no choice. I could foresee many, many sleepless nights and a life filled with regret if I would have refused to help the Franks. And this was not the kind of life I was looking for at all. SCHULTZ: Gies explained another motivation for emphasizing her modesty. She said if people are allowed to think it takes remarkable qualities to act boldly on behalf of others, few will attempt it. Ms. GIES: People should never think that you have to be a very special person to help those who need you.Which detail best illustrates Miep Giess purpose in this excerpt?People should never think that you have to be a very special person to help those who need you.I could foresee many, many sleepless nights and a life filled with regret if I would have refused to help the Franks.And this was not the kind of life I was looking for at all. Gies explained another motivation for emphasizing her modesty. At a meeting of musicians, 56 of the musicians play the piano but only 35 play the violin. What is the minimum number of people at the meeting who play both piano and violin? |-10| divided by 2 x |5| The graph of the equation x + 3y = 6intersects the y-axis at the point whosecoordinates are: (Find the y intercept)which answer?(0,2)(0,6)(0,18)(6,0) How many men did it take to capture Antigonea. 2b. 5c. 1d. 7 Transcribe the following DNA strand into mRNA and translate that strand into a polypeptidechain, identifying the codons, anticodons, and amino acid sequence.DNA: CGATACAATGGACCCGGTATGCGATATCC