Solve the system by substitution.

-3x-4y=11

y=2x

Answers

Answer 1

Answer:

x = -1, y = -2

Step-by-step explanation:

-3x-4y=11

y=2x

Plug in 2x for y:

-3x-4(2x)=11

-3x-8x = 11

-11x = 11

x =-1

Plug in x in y = 2x

y = 2(-1)

y = -2

Answer 2

Answer:(-1,-2)

Step-by-step explanation:


Related Questions

Andy, Fergus, Evelyn, and Margaret are collecting cans for recycling. Before lunch they have collected a total of 173 cans. At the end of the day, the total number of cans collected can be represented by the expression 173 + n . What does the variable n in the expression represent?

Answers

Answer:

n = The number of can collected after lunch

Step-by-step explanation:

Andy, Fergus, Evelyn, and Margaret are collecting cans for recycling.

From the question, the told number rod cans collected before lunch = n

We are told that :

At the end of the day, the total number of cans collected can be represented by the expression 173 + n .

The total number of cans = Number of cans collected before lunch + Number of cans collected after Lunch

Hence:

173 + n = 173 + Number of cans collected after Lunch

Therefore, the variable n = Number of cans collected after Lunch

Point Q was rotated about the origin (0,0) by -45 degrees

Answers

Answer:

0,0

Step-by-step explanation:

The point Q was rotated about the origin (0,0) by -45 degrees, so the new coordinate point is (√2, 4√2).

From the given graph, the coordinates of point Q are (-3, 5).

Rotating the co-ordinate axes through an angle of 45° in anti-clockwise direction is equivalent to rotating the point through an angle of -45° about origin.We will use rotation from complex numbers to solve this.

Let x + iy the new complex number

(-3+5i)[tex]e^{\frac{-\pi i}{4} }[/tex]

= (-3+5i)((1-i)/√2)

= (-3+5i)(1-i) ×1/√2

= (-3+5i+3i-5i²) ×1/√2

= (-3+8i+5) ×1/√2

= (2+8i) ×1/√2

= (2/√2 + 8i/√2)

= (√2 + 4√2i)

So, the coordinates are (√2, 4√2)

Therefore, the point Q was rotated about the origin (0,0) by -45 degrees, so the new coordinate point is (√2, 4√2).

Learn more about the rotation here:

brainly.com/question/1571997.

#SPJ4

rewrite as as whole number 40/5

Answers

Answer:

8

Step-by-step explanation:

Just do 40 divided by 5.

please help me for 50 point

Answers

Answer:

54

Step-by-step explanation:

So If this tells you what 'm' and 'n' are, you just put them inside.

First do the M so then it will be 5 * 10 which is 50 then we just first leave it there.  Then we start putting in that N. We know that N is 4. Then it's N to the power of 2. I recommend since there's already a 4 on the bottom, just do 4 * 4 there. Then you see there is a 4 on the denominator while there are double 4's on the numerator. Then you just cross one 4 on the denominator and one on the numerator to simplify it.

Then all there is is 50 + 4 = 54

So 54 is our answer.

Answer:

Step-by-step explanation:

10m + n^2/4           (m=5 , n=4)

(10*5) + (4^2/4) =

50 + 4 =

54

Me and my daughter are having a disagreement on this question, I would appreciate the help.

Answers

Answer:

(4t - 8/5) - (3 - 4/3t) = 16/3t - 23/5

5(2t + 1) + (-7t + 28)= 3t+33

(-9/2t +3) + (7/4t + 33) = -11/4c+56

3 (3t-4) - (2t + 10)= 7t -22

Sooo Sorry that it took soooo long! Hope this helps!!!

Happy holidays!!

A cell phone tower casts a 100 foot shadow.At the same time, a 4 ft 6 inch post near the tower casts a shadow of 3 ft 4 inches. What is the height of the tower? Please help I need an answer ASAP​

Answers

Answer:

https://brainly.com/question/11428290

Step-by-step explanation:

You can go to this webpage and see if you find what you are looking for. :)

250 ft.

3ft 4in = 4ft 6in - 1ft 2in.

i dunno how to explain it any better. lol sorry.

2(6-x)=3 please help

Answers

It’s impossible what are you doing Distributed property or solving for x?

Answer:

x = 4.5

Step-by-step explanation:

Let's solve this together!

First you would want to multiply 6 and x:

6×2 = 12

x×2 = 2x

Then you would want to subtract 12 from 3:

3+12 = 9

Then divide 9 by 2:

9÷2 = 4.5

x=4.5

That's it!

Hope this helped! :)

What is
25 3/10 + 376 77/100

Answers

Answer: 3 parrots

Step-by-step explanation:

Answer:

402 7/100

Step-by-step explanation:

Hope this helps!

Find the value of x in the
following parallelogram:
2x - 1
11
7
x = [?]

Answers

Answer:

[tex]x = 4[/tex]

Step-by-step explanation:

See attachment for complete question

From the attachment, the parallelogram has two diagonals. And the diagonals of a parallelogram bisect one another.

Because 2x - 1 and 7 are opposite sides of a diagonal; We can say that:

[tex]2x - 1= 7[/tex]

Add 1 to both sides

[tex]2x - 1 + 1 = 7 + 1[/tex]

[tex]2x = 8[/tex]

Divide through by 2

[tex]x = 4[/tex]

All of the following are equivalent, except _____.

(8 + 3)x
11x²
11x
8x + 3x






hellllllllllllppppppppppp

Answers

Answer:  B)   11x^2

Explanation:

Choice A combines to 11x since the 8+3 simplifies to 11.

Choice D is a very similar story. Think of having 8 boxes, which we denote in shorthand as 8x. Then adding on 3 more boxes leads to adding on 3x. Having 8 boxes plus another 3 boxes gives 8+3 = 11 boxes total. So that's why 8x+3x = 11x. Alternatively, we can factor out the x to say 8x+3x = (8+3)x.

This shows choices A,C, and D are equivalent expressions. Choice B is the odd one out.

I need help ASAP pic below

Answers

Answer:

Step-by-step explanation:

2) ∠A + ∠B = 146       {Exterior angle theorem}

5y + 3 + 4y + 8 = 146

5y + 4y + 3 + 8 = 146           {combine like terms}

         9y + 11 = 146

               9y = 146 -11

               9y = 135

                 y = 135/9

y = 15

3) m∠A = 5y + 3

              = 5*15 + 3

              = 75 + 3

A = 78

4) m∠B = 4y + 8

            = 4*15 + 8

            = 60 + 8

      m∠B = 68

5) m∠ACB + m∠A + m∠B = 180   {Angle sum property of triangle}

 m∠ACB  + 78 + 68 = 180

           m∠ACB + 146 = 180

                       m∠ACB = 180 - 146

                      m∠ACB = 34

What is 3(2x-6)-11=4(x-3)+6

Answers

Answer:

[tex]x=11.5[/tex]

Step-by-step explanation:

Answer:

the answer is x=23/2 I think you can simplify that

(x-2)= - 1/4(x-8) what does x equal?

Answers

Answer:

16/5 or 3 1/5 i think

Step-by-step explanation:

Answer:

x = 16/5.

As a decimal this would be x = 3.2.

Step-by-step explanation:

On the right, distribute the -1/4 to the (x - 8). Do this by multiplying -1/4 to each term in the parenthesis. Then, solve for x by combining like terms.

Help I forgot! How do you find slope? I have the change, but need the slope!

Answers

Answer:

(y2 - y1)/(x2-x1)

Step-by-step explanation:

if you have 2 points (x1,x2) and (y1,y2), just plug it in the formula for slope m

m = (y2 - y1)/(x2-x1)

rise over run! count the rise and count the run and make it a fraction and solve

Write ✓-49 as an imaginary number using i.​

Answers

answer: 7i
explanation: √-1 is i because a negative square root is imaginary. you can take out the negative from the inside of the square root and replace it with i on the outside. that leaves you with √49, which is 7, and that gives you 7i

What are the zeros of the function defined by 2x^2 - 9x + 4?
O A. -1/2, -4
O B. -1/2, 4
OC. 1/2, -4
O D. 1/2, 4

Answers

The answe is c I think

What is a 217 for the sequence -10,-7, -4,-1, ...

Answers

Answer:

a(217)=638

Step-by-step explanation:

a(n) = a +(n-1)d

a=-1

d=-7+10=-4+7=3

a(n) = -10 +(n-1)3

a(217) = -10 +(217-1)3

         = -10+648

         =638

hope this helps

Determine the function rule for the following input/output table.
inputs
2
3
4
5
6
outputs
21
31
41
51
61

Answers

Answer:

Every time the input goes up by 1 the output increases by 10.

Step-by-step explanation:

Sumalee and Scott each improved their yards by planting daylilies and ivy. They bought their
supplies from the same store. Sumalee spent $93 on 6 daylilies and 3 pots of ivy. Scott spent
$196 on 13 daylilies and 6 pots of ivy. Find the cost of one daylily and the cost of one pot of ivy.

Answers

Answer:

The cost of one daylily is $10 and the cost of one pot of ivy is $11

Step-by-step explanation:

To solve the question we will form a system of equations

Assume that the cost of 1 daylily is x and the cost of 1 pot of ivy is y

∵ Sumalee spent $93 on 6 daylilies and 3 pots of ivy

→ Multiply x by 6, y by 3, then add the products and equate the sum by 93

6x + 3y = 93 ⇒ (1)

∵ Scott spent $196 on 13 daylilies and 6 pots of ivy

→ Multiply x by 13, y by 6, then add the products and equate the sum by 196

13x + 6y = 196 ⇒ (2)

Now we have a system of equations to solve it

→ Multiply equation (1) by -2

∵ -2(6x) + -2(3y) = -2(93)

-12x - 6y = -186 ⇒ (3)

→ Add equations (2) and (3)

(13x + -12x) + (6y + -6y) = (196 + - 186)

∴ x + 0 = 10

x = 10

→ Substitute the value of x in equation (1) to find the value of y

6(10) + 3y = 93

∴ 60 + 3y = 93

→ Subtract 60 from both sides

∵ 60 - 60 + 3y = 93 - 60

∴ 3y = 33

→ Divide both sides by 3

y = 11

The cost of one daylily is $10 and the cost of one pot of ivy is $11

(Use Solving Systems by Graphing to find a solution for this question)
One cellphone provider DU charges AED10 per month plus an activation fee of AED20. A second cellphone provider ETISALAT charges AED11 per month plus an activation fee of AED15. For what number of months is the cost of either cellphone provider the same?

Answers

Answer:

5 months

Step-by-step explanation:

One cellphone provider charges AED10 per month plus an activation fee of AED20.

If I used the services of this cellphone provider for x months, total charges for the services,

y = 10x + 20 --------(1)

Similarly, charges for the second cellphone provider for x months of uses will be,

y = 11x + 15 -------(2)

Input-output table for equation (1)

x      1           2            3            4            5

y     30        40         50          60          70

Input output table for equation (2)

x      1           2            3            4            5

y     26        37          48          59         70

From these tables, we find (5, 70) is a common point for both.

It reveals that after the uses of 5 months charges for both the cellphone providers will be same (y = $70)

someone please help me. show your work for brainliest.

find the center and radius of the circle represented by the equation x^2 + y^2 - 4y - 8 = 0

Answers

Answer:

Attached file

Step-by-step explanation:

plzzzzzzzz help
The regular price of a coat is $35.25. During a sale, the coat rang up for $19.99. What was the percent off of the coat during the sale? (5 points)

a
The sale was for a 43% decrease.

b
The sale was for a 76% increase.

c
The sale was for a 76% decrease.

d
The sale was for a 43% increase.

Answers

Answer:

a

The sale was for a 43% decrease.

Step-by-step explanation:

The computation of the percent off of the coat during the sale is shown below:

Regular price is $35.25

And, in the sale the price is $19.99

So, the percent off would be

= ($35.25 - $19.99) ÷ ($19.99)

= 43% decrease

hence, the percent off of the coat during the sale is 43% decrease

Therefore the correct option is a.

And, all the other options are incorrect

Pamela is 5 years younger than Jiri. The sum of their ages is 55. What is Jiro's age?

Answers

Answer:

ummm i firgit

Step-by-step explanation:

I forgot bc well I am dum

Answer:

The answer is 30

Step-by-step explanation:

j+j-5=55

2j=60

=30

What is the equation of the line that passes through the point (3,5) and has a slope
of 2?

Answers

Answer:

y-5=2(x-3)

Step-by-step explanation:

y-y1=m(x-x1)

Answer:

y=2x-1

Step-by-step explanation:

trust me, it's that

Armoni took a quiz. On her quiz, she got a 95%. If there were 20 questions on the quiz, how many did Armoni get correct?

Answers

Answer:

19 questions right

Step-by-step explanation:

95% > .95

.95 * 20 = 19

Armoni got 19 questions correct

hope it helps!

Please show steps on how you simplified it

Answers

Answer:

4(3^2)

3^2=9

4(9)= 36

Answer:

4(3•3)

4(9)

36

Step-by-step explanation:

3 to the second power is equal to 3•3, which is equal to 9

Then you do 4 times 9, equals to 36

what is the graph of y= 2/3x

Answers

Use desmos it’s free and you just put in the problem and it puts it on a graph for you

Answer:

Hope this helps you.

Step-by-step explanation:

I posted it.

least common multiple of 12 and 3

Answers

Answer:

Answer is 12

12x1=12

3x4=12

Step-by-step explanation:

Its the least number.

Answer:

It is exactly 12

Step-by-step explanation:

I hope this helped you

Can i get branliest and heart please

Thanks!

Muriel says she has written a system of two linear equations that has an infinite number of solutions. One of the equations of the system is 3y = 2x – 9. Which could be the other equation? 2y = x – 4.5 y = y equals StartFraction 2 over 3 EndFraction x minus 3.x – 3 6y = 6x – 27 y = y equals StartFraction 3 over 2 EndFraction x minus 4.5.x – 4.5

Answers

Answer:

B is correct

Step-by-step explanation: an infinite number of solutions means a coincident line...it is the same line

3y = 2x - 9...divide by 3

y = 2/3x - 3...hmm...same line as answer choice b....they are coincident lines and have infinite solutions

Answer:

the answer is B).

Step-by-step explanation:

someone deleted my answer:(

6a-4a(3-4)=

Please help me

Answers

Answer:

Step-by-step explanation:

10a

Other Questions
25 POINTS AND BRAINLIEST!! Clay wants to ride a Ferris wheel that has a radius of 80 feet and is suspended 9 feet above the ground. The wheel makes 6 revolutions in one minute. Find the period and amplitude. Read the following excerpt from "Woman Who Helped Hide Anne Frank Dies at 100" by Teri Schultz.Ms. MIEP GIES: I, myself, I'm just a very common person. I simply had no choice. I could foresee many, many sleepless nights and a life filled with regret if I would have refused to help the Franks. And this was not the kind of life I was looking for at all. SCHULTZ: Gies explained another motivation for emphasizing her modesty. She said if people are allowed to think it takes remarkable qualities to act boldly on behalf of others, few will attempt it. Ms. GIES: People should never think that you have to be a very special person to help those who need you.Which detail best illustrates Miep Giess purpose in this excerpt?People should never think that you have to be a very special person to help those who need you.I could foresee many, many sleepless nights and a life filled with regret if I would have refused to help the Franks.And this was not the kind of life I was looking for at all. Gies explained another motivation for emphasizing her modesty. At a meeting of musicians, 56 of the musicians play the piano but only 35 play the violin. What is the minimum number of people at the meeting who play both piano and violin? |-10| divided by 2 x |5| The graph of the equation x + 3y = 6intersects the y-axis at the point whosecoordinates are: (Find the y intercept)which answer?(0,2)(0,6)(0,18)(6,0) How many men did it take to capture Antigonea. 2b. 5c. 1d. 7 Transcribe the following DNA strand into mRNA and translate that strand into a polypeptidechain, identifying the codons, anticodons, and amino acid sequence.DNA: CGATACAATGGACCCGGTATGCGATATCC Jake walks to town every fifth day. Sam rides his bike to town every fourth day. What is the first day they are likely to meet in town? Why do numA and numB have the same scope in the subtract function? def subtract(numA, numB): return numA - numB def divide(numC, numD): return numC / numD answer = subtract(24,6) print (answer) The coda is considered to be Which process is best illustrated by the diagram? Billy has a gift card with a $160 balance. He buys several video games that cost $40 each. After the purchases, his gift card balance is $40. Enter an equation to help find out how many video games Billy bought. Which fraction is represented by point A on the number line? who want to play among us Celeste transferred 100 percent of her stock in Supply Chain Company to Marketing Corporation in a Type A merger. In exchange, she received stock in Marketing with a fair market value of $562,000 + $562,000 in cash. Celeste's tax basis in the Supply Chain stock was $1,320,000. What amount of loss does Celeste recognize in the exchange and what is her basis in the Marketing stock she receives? QUICKLY PLEASE!!!Respond to the following in three to five sentences.What is the purpose of netiquette guidelines? In an experiment, two unknown compounds (one an ether and the other an amine) of equal molecular mass were dissolved in water. The result of the experiment is shown in the table.Solubility ComparisonUnknown Compound Solubility (g/100 ml water)A 4B 0.25Which of the following correctly explains the identity of Compound A and its solubility? It is an amine; it contains a nitrogen atom that will allow nitrogen-hydrogen bonds to form while in water. It is an ether; because the oxygen atom is within the carbon chain, so it is free to form oxy-hydrogen bonds to make it more soluble. It is an ether; the high polarity of the oxygen-hydrogen bond makes it more soluble. It is an amine; because the lower electronegativity of N than H makes it more soluble. . Why is spell check not completely reliable as an editor? is francium found in nature or lab? what is a film interpretation