Answer:
See the answer below
Explanation:
When the batteries in a flashlight become dead and the flashlight no longer works, it means that the chemical energy present in the battery has been converted to electrical energy to power the touch and eventually got lost to the environment as heat.
In a typical flashlight that works with batteries, the chemical energy in the batteries is converted to electrical energy, and this powers the bulbs in the flashlight. Gradually, the electrical energy is converted to heat energy and this is lost to the environment by radiation. When all the energy is lost to heat, the batteries are said to be dead and the flashlight stops functioning.
What is the primary cause of deforestation?
Select one:
a. Conversion of land for crops and pasture land
b. Harvesting for fuel wood
c. Paper industry pressures
Answer: B
Explanation: Googl/What is the primary cause of deforestation?
Word Bank: Slowly, Within, Different, Transmitted, Densely, Sonar, Solids, Absorption, Bounces
Mechanical waves react to different mediums in different ways. Some mechanical waves are _________________ through a medium, meaning they pass through the medium. The way in which waves are transmitted depends upon the type of material. In ________________, mechanical waves travel rapidly, because the molecules are ___________________ packed. In liquids and air, however, mechanical waves travel more _________________, because the molecules are spread farther apart.Other mechanical waves are reflected off a medium. When a mechanical wave is reflected, it ______________ off the medium and then travels in a ______________ direction. ______________ is an application that uses sound wave reflection to determine how deep water is. A third way mechanical waves react to a medium is _______________. When a mechanical wave is absorbed, it remains __________________ a medium and is not transmitted to another medium.
Answer:
Mechanical waves react to different mediums in different ways. Some mechanical waves are TRANSMITTED through a medium, meaning they pass through the medium.
The way in which waves are transmitted depends upon the type of material. In SOLIDS, mechanical waves travel rapidly, because the molecules are DENSELY packed. In liquids and air, however, mechanical waves travel more SLOWLY, because the molecules are spread farther apart.
Other mechanical waves are reflected off a medium. When a mechanical wave is reflected, it BOUNCES off the medium and then travels in a DIFFERENT direction. SONAR is an application that uses sound wave reflection to determine how deep water is.
A third way mechanical waves react to a medium is ABSORPTION. When a mechanical wave is absorbed, it remains WITHIN a medium and is not transmitted to another medium.
The fill in the blanks will be filled with TRANSMITTED, SOLIDS, DENSELY, SLOWLY, BOUNCES, DIFFERENT, SONAR, ABSORPTION, WITHIN
Mechanical waves:react to distinct mediums in various ways. Some mechanical waves are TRANSMITTED via a medium, meaning they pass via the medium. The way in which waves are transmitted based upon the type of material. In SOLIDS, mechanical waves travel rapidly, due to the molecules are DENSELY packed.
In liquids and air, however, mechanical waves travel more SLOWLY, due to the molecules being spread farther apart.Other mechanical waves are reflected off a medium.
When a mechanical wave is reflected, it BOUNCES off the medium and then travels in a DIFFERENT direction. SONAR is an application that uses sound wave reflection to determine how deep water is.
A third way mechanical waves react to a medium is ABSORPTION.When a mechanical wave is absorbed, it remains WITHIN a medium and is not transmitted to another medium.
Learn more about the waves here: https://brainly.com/question/3102539
what are the similarities and differences between carrier proteins and channel proteins
plz help me i beg of you!???
Answer:
Pretty sure it's D, because the birds beak evolves to crush those grains as a result of certain food available in their habitat, although it does not say "diet" as an option so D is your best guess.
Explanation:
how is cancer cell division different from regular cell division
How do the hormones of the endocrine system act as a feedback mechanism for the menstrual cycle?
In positive feedback, rising levels of hormones feedback to increase hormone production. During most of the menstrual cycle, estrogen and progesterone provide negative feedback to the hypothalamus and pituitary gland. This keeps their levels more or less constant.
In negative feedback, rising levels of hormones feedback to the hypothalamus and pituitary gland to decrease the production of the hormones. In positive feedback, rising levels of hormones feedback to increase hormone production. During most of the menstrual cycle, estrogen and progesterone provide negative feedback to the hypothalamus and pituitary gland. This keeps their levels more or less constant. During days 12–14, however, estrogen provides positive feedback to the hypothalamus and pituitary gland. This causes a rapid rise in the production of estrogen by the ovaries and leads to ovulation.
What can you observe with the cartoon? What is your own interpretation of it?
Answer:
i think that: the volcanos are talking to eachother as if they are humans and they do not understand that the reason his neighbour "blew up" (errupted) is because they are volcanos
1. What is an operon?
a. The binding site for a repressor PRO.
b. Any group of genes responsible for the metabolism of lactose in a prokaryotes or eukaryotes.
c. A cluster of genes under the control of a promoter.
d. A regulatory gene.
Answer:
The answer is D
Explanation:
The picture shows respiratory epithelium in the lungs. The cilia, or fingerlike projections are MOST LIKELY there to
A)
move liquid.
B)
catch debris.
C)
secrete mucus.
D)
transmit impulses
Answer:
B. catch debris in the lungs
Need help will mark Brainliest
Answer: the secondary response to Antigen A is greater because the lymphocytes remember the antigen
which of the following are part of the central nervous system?
Answer:
The central nervous system is made up of the brain and spinal cord
Explanation:
ion if that's the answer you were looking for but here go.
3. A house has several systems, such as the electrical system, plumbing system, and
heating and cooling system. In what ways are the systems of a house similar to
human body systems?
3.4.3 Lab: Why are cells so small?
Answer: The important point is that the surface area to the volume ratio gets smaller as the cell gets larger. Thus, if the cell grows beyond a certain limit, not enough material will be able to cross the membrane fast enough to accommodate the increased cellular volume. ... That is why cells are so small.
Explanation: because they can absorb nutrients much more efficiently. Because they are smaller they can efficiently absorb enough food. ... When a cell doubles in size the volume increases much more then the surface area, which is why large cells cannot receive enough food efficiently for their volume. Cells are small because they are more efficient as smaller entities. Information within small cells is transmitted more quickly and efficiently than within larger cells. ... Thus a higher cell surface area-to-volume ratio, i.e., smaller cell size, is desired for most efficient cellular activity.
The cells are so small because their small size allows them to take in food and get rid of the waste.
The cells are the basic structural and functional unit of all organisms on earth except the Viruses. The size of the cell is so little it allows the organism to maximize the ration of surface area to volume. Smaller cells are expected to have greater ratio which promotes more molecules as well as ions to move across the plasma membrane.The small size of the cell facilitate to get the nutrients inside the cell and waste outside the cell quickly. Hence, small size of cell facilitates to get food inside and get rid of waste.Learn more about cell:
https://brainly.com/question/3142913
6. How can an introduced species affect an ecosystem?
Answer:
When a new and aggressive species is introduced into an ecosystem, it may not have any natural predators or controls. It can breed and spread quickly, taking over an area. Invasive species can change the food web in an ecosystem by destroying or replacing native food sources.
Explanation:
I majored in Biology
Choose all the right answers. Which items are common features of most mammals? produce milk come in all sizes fertilized egg develops inside the body have fins eggs laid outside of body have scales some mammals live in water all have hair or fur
Answer: Some mammals live in water all have hair or fur.
Explanation:
In your lab group, you are investigating the properties of unknown types of matter. Your teacher gives you a "detective's kit
consisting of: vinegar (an acid), pH strips, and water. She asks you to design experiments to determine the chemical properties of the
unknowns. Select ALL of the experiments you might perform to observe chemical properties.
A)
measuring the pH
B)
measuring the mass
C)
measuring the density
D)
measuring the boiling point
E)
checking for reactivity with vinegar
Answer:
A: measuring the pH
E:checking for reactivity with vinegar
Explanation: I don't have one
The chemical property of the unknown substance can be measured by checking for reactivity with vinegar.
The chemical properties of a substance are those properties of a substance that we can observe by allowing the substance to be changed via a chemical reaction. In other words, chemical properties are observed by passing the substance through a chemical reaction.
Hence, the experiment that you will need to perform in order to determine the chemical properties of the unknown substance is checking for reactivity with vinegar.
Learn more: https://brainly.com/question/25105283
Hemophilia is a recessive sex-linked trait. A non-hemophiliac man and woman marry and
have a daughter who is a hemophiliac. The father of this child suspects infidelity and is
considering a divorce. Does he have sufficient evidence of infidelity? Explain.
The father does not have sufficient evidence of infidelity as the parent's genotype is not mentioned which could have the recessive trait of hemophilia being inherited to the daughter.
What is hemophilia?Hemophilia is a disorder which is rare which results when the blood does not clot in it's usual way as it does not have sufficient blood-clotting factors .A person suffering from hemophilia can bleed for a longer period of time resulting in blood loss.
It is almost always that hemophilia occurs genetically . Treatment of hemophilia include replacement of the specific blood clotting factor that is reduced. Symptoms of hemophilia vary from person to person depending on the level of the clotting factors.
Signs and symptoms include excessive bleeding ,large or deep bruises, pain or swelling in joints ,nosebleeds,etc.
Learn more about hemophilia,here:
https://brainly.com/question/1428363
#SPJ2
Daphne identifies the entire sequence of nucleotides in a gene. Based on this information and the genetic code, she predicts the sequence of amino acids in the protein that the gene codes for. What is the MOST LIKELY reason that Daphne’s prediction would be incorrect?
The gene codes for a carbohydrate, and not a protein.
A mutation changes the genetic code that the cell uses.
The cell removes introns from pre-mRNA.
The cell removes introns from DNA.
Answer:
The cell removes introns from pre-MRNA
Explanation:
What is the independent variable?
What is the dependent variable?
Answer quickly please
How do roundworms differ from earthworms?
A. They have a cylindrical body.
B. They have a body that is tapered at both ends.
C. They reproduce sexually.
D. They are not divided into segments.
Answer:
Key difference: Earthworms, Tapeworms and Roundworms are long and cylindrical shaped worms. The basic difference between them is that Earthworms are segmented invertebrates belonging to the phylum Annelida, Tapeworms are flatworms belonging to the phylum Platyhelminthes, and Roundworms are parasitic worms belonging to the phylum Nematoda.
Explanation:
So: A?
Answer:
A
Explanation:
They have a cylindrical body.
Have a great day and good luck
please helpp if you dont know the answer that's ok but please helpp
3. What type of bond holds the backbone together?
A. Covalent
B. Hydrogen
C. lonic
Answer: The answer is B
Explanation:
jake tested the effect of purple light on the growth of eggplants
Find the independent & dependent variables.
Answer:
Independent variable : color of light. 2. Dependent variable : height/growth of plant. 3. Independent variable : color of light. 2. Dependent variable : height/growth of plant. 3.
Explanation:
Answer:
Independent variable : color of light. 2. Dependent variable : height/growth of plant. 3. Independent variable : color of light. 2. Dependent variable : height/growth of plant. 3.
Explanation:
Which of the following describes a negative feedback loop?
A. When the heart rate is too high, the body releases hormones that continually increase the heart rate higher.
B. When a pregnant woman is in labor, the body releases hormones that increase the intensity of contractions, which then increases the secretion of the same hormones.
C. When blood sugar concentration is above normal, the endocrine system releases hormones that lower the blood sugar concentration until it reaches a normal level, and the release of the hormones slows.
D. When a person is jogging, the body releases hormones that continually decrease the rate of oxygen supply to the legs.
ANSWER is A
When blood sugar concentration is too low, the endocrine system secretes hormones that increase blood sugar concentration to a normal level.
Explanation:
Apply: Which type of moth do you think was more common before the 19th century, when most trees were light in color?
Answer:
light moths
Explanation:
yes their were most light color in most trees
Light moths was more common before the 19th century, when most trees were light in color.
What are the functions of light moths?Insects, like moths, are drawn to bright lights because they make it difficult for them to navigate. It's a common sight, particularly in the summer: The lights, like lamps, were surrounded by moths and other insects.
Most nocturnally dynamic moths are drawn to light, a peculiarity known as sure phototaxis. However, because they are phototactic, some species, like the Old Lady (Mormo maura), tend to avoid it.
No one really knows why moths are drawn to light, but there are a few theories, and they also like the smell of fermented sugar and ripe fruit, which are both food sources.
Learn more about light moths:
https://brainly.com/question/14452844
#SPJ3
Allopatric speciation is most likely to occur when a ______ population is separated from the ______ population.
HELP PLEASEEE
TACTTAGAGGCACCACATGGGCCTTGCACT to mRNA
Answer:
I don't know the answer
Explanation:
is is this even a question cos I don't think so.
1. Which of the following describes the amount of organic material that is available for transfer to the next trophic level after subtracting material used for respiration?
-Gross Primary productivity
-Biomass
-Net Primary productivity
0r
-Primary productivity
2. Suppose a plant is eaten by a mouse, the mouse is consumed by a snake, and the snake is in turn consumed by a hawk. What could be assumed about the level of available organic matter in the mouse versus the plant?
-There will be less organic matter available.
-There will be more organic matter available.
-Organic matter does not transfer between the plant and the mouse.
0r
-They both have the same amount of organic matter.
3. How does biomass change from lower to higher trophic levels?
-It fluctuates.
-It increases.
-It decreases.
0r
-It stays the same.
4. The incomplete burning of _____ in gasoline is known to create black carbon and contribute to global warming.
-ethanol
-methane
-carbon
0r
-carbon dioxide
5. Why are there less secondary consumers in an ecosystem than producers?
-Around 90% of energy from one trophic level to the next is available.
-There is less land to use for habitat after the producers grow.
-More tertiary consumers will eat secondary consumers over producers.
0r
-There isn’t enough energy available to support more secondary consumers.
Net primary productivity is the amount of organic material that is available for transfer to the next trophic level after subtracting material used for respiration.
When a plant is eaten by a mouse, the mouse is consumed by a snake, and the snake is in turn consumed by a hawk. In this case, there will be less organic matter available.
Biomass change from lower to higher trophic levels by decreasing.
The incomplete burning of ethanol in gasoline is known to create black carbon and contribute to global warming.
There is less secondary consumers in an ecosystem than producers because there isn’t enough energy available to support more secondary consumers.
It should be noted that global warming brings about the increase in the temperature around the world.
Read related link on:
https://brainly.com/question/8303820
what is anaerobic respiration
Answer:
Anaerobic respiration is the type of respiration through which cells can breakdown sugars to generate energy in the absence of oxygen.
3. How does changing the number of neutrons affect an atom?
Answer:
The change of number of neutrons does not affect the charge of the atom. All it will affect is your average atomic mass which is the sum of protons and neutrons.
Explanation: Hope this can help! ^^
Answer:
It will change the isotopes.