Answer:
they vibrate faster
Explanation:
Answer:
They Vibrate Faster
Explanation:
Did it on Edge 2020
-Its C
Which organisms are prokaryotes?
A. archaea
B. fungi
C. protists
D. plants
A AAAAAAAAAAAAAAAAAAAA
ARCHAEA
A student produces a labeled drawing of a virus for a presentation. The student states that the capsid has a function similar to the nuclear membrane found in animal cells.
Which of these describes the similar functions of capsids and nuclear membranes?
Both code for the proteins needed for reproduction of the structures.
Both code for the proteins needed for reproduction of the structures.
Both provide energy for activities in the structures.
Both provide energy for activities in the structures.
This question is incomplete, here is the complete question:
A student produces a labeled drawing of a virus for a presentation. The student states that the capsid has a function similar to the nuclear membrane found in animal cells. Which of these describe the similar functions of capsids and nuclear membranes?
A. Both transport proteins throughout the structures
B. Both provide energy for activities in the structures
C. Both protect genetic information for the structures
D. Both code for the proteins needed for reproduction of the structures
The correct answer is C. Both protect genetic information for the structure.
Explanation
The capsid is the structure that protects and contains the genetic information of a virus, it is composed of proteins. On the other hand, the nuclear membrane of an animal cell is a structure that allows the cell to protect the DNA information, and to separate the chromosomes from the rest of the cell. According to the above, the capsid and the nuclear membrane of an animal cell have a similar function to protect the genetic information. So, the correct answer is C. Both protect genetic information for the structure.
Viruses are known to have different many shapes and sizes. The option that best describe the similar functions of capsids and nuclear membranes is that both protect genetic information for the structures.
The shapes of viruses are divided into four groups. They are;
FilamentousIsometric (or icosahedral) enveloped, head tail.The size and shape of a various can be determined by the amount and arrangement of the proteins and nucleic acid of the viruses. Note that the nucleic acid and proteins of each class of viruses often comes togetheer by themselves and form a structure called a nucleoprotein.
Learn more about Virus from
https://brainly.com/question/17173059
what are bony platelet?
Answer:
a minute colorless anucleate disklike body of mammalian blood that is derived from fragments of megakaryocyte cytoplasm, that is released from the bone marrow into the blood, and that assists in blood clotting by adhering to other platelets and to damaged epithelium — called also blood platelet, thrombocyte.
Similarly, you may ask, what is the medical term for platelets?
The medical term for having too many platelets is thrombocytosis, and there are two types: Primary or essential thrombocytosis – Abnormal cells in the bone marrow cause an increase in platelets, but the reason is unknown.
What is the medical name for platelets?
Platelet: An irregular, disc-shaped element in the blood that assists in blood clotting. During normal blood clotting, the platelets clump together (aggregate). Although platelets are often classed as blood cells, they are actually fragments of large bone marrow cells called megakaryocytes
Explanation:
Platelets are fragments of megakaryocytes, which are very large cells in the bone marrow. They aid in the formation of blood clots, which slow or stop bleeding and aid in the healing of wounds.
What is blood clotting?When a blood vessel is injured, blood clotting, or coagulation, is an important process that prevents excessive bleeding.
Platelets (a type of blood cell) and proteins in plasma (the liquid component of blood) collaborate to stop the bleeding by forming a clot over the injury.
Red bone marrow is responsible for the production of blood cells (hematopoiesis). Stem cells in your red bone marrow (hematopoietic stem cells) produce red, white, and platelets, which are all components of your whole blood.
Platelets are fragments of megakaryocytes, which are very large bone marrow cells. They promote the formation of blood clots, which slow or stop bleeding and aid in wound healing.
Thus, these are the main functions of platelets.
For more details regarding blood clotting, visit:
https://brainly.com/question/11230651
#SPJ2
What happens over time to rock that is stressed?
A The rock becomes gravel
D. The color of the rock changes.
C. The rock melta to liquid
D. The shape of the rock deforms
SUMMIT
Answer:
The rock becomes gravel
Explanation:
Answer:
The shape of the rock deforms
Explanation: i took a quiz on a.pex and it was right
Help me with this
A . Name the separation technique that can be used to separate lighter particles and heavier particles. Explain the principle behind this separation method
Answer:
Purification techniques
Answer:
It is just the techniques purification
Explanation:
Why is meiosis important for organisms?
It allows for genetic variation among organisms.
It determines which genes are dominant and which are recessive.
It produces genetically identical cells.
It provides a means of asexual reproduction.
IM TIMED
Answer:
A - It allows for genetic variation among organisms.
Explanation:
Its basically sex or sexual reproduction. Which later allows for genes to spread and vary. Which create families in animals and humans.
Because Meiosis is Sexual Reproduction
Hope this Helps!
:D
A. Amber and evolution
B. Cast and imprint
C. Theory, cast
D. Carbon dating and radioactive isotopes
Answer:
A. Amber and evolution
HURRY PLZ
2. Define Homologous Chromosomes
A. Chromosomes that make up each pair of chromosomes in a body cell, for each of
the 23 pairs in humans, one comes from mom, the other from dad,
B. Copies of the original chromosomes
C. Allele that hides the recessive allele,
D. Pure
Which of the following is NOT a threat to living ocean organisms?
A. evaporation
B. oil spills
C. pollution
D. over fishing
Which of the following explains why a mountain can become flat after millions of years?
Weathering and erosion cause the soil from the mountain to erode down the mountain's slope.
Heat from the sun causes the soil to dry out, decreasing the mountain's volume and causing it to sink
Animals walking and running across the land compact the soil over time until it becomes flat
The mountain crumbles away after losing all its nutrients because there are too many trees
Answer:
weather and erosion
Explanation:
Recovering Ecosystems Worksheet Section 1: Select the Kitakami River region, the Abukuma Highlands, or Japan's coastal habitat as the ecosystem you want to help with recovery. List the main problem faced by this ecosystem as described in the lesson. Then list at least two sub-problems that need to be considered to solve the main problem. List the sub-problems in order of most to least important. In the rationale column, explain why you placed your sub-problems in the order you selected. Main Problem Sub-Problems Rationale Section 2: Conduct internet research on your selected ecosystem to help you generate a list of three criteria and two constraints. Your criteria and constraints should consider relevant factors to the problem, such as costs, reliability, safety (to humans and wildlife), human needs, environmental impact, local biodiversity, and the aesthetics of the area. List the criteria in order of most to least important and assign each to a related sub-problem. In the rationale column, explain why you placed your criteria in the order you selected. Constraints Criteria Rationale Which Sub-Problems does this criteria address? Section 3: For at least one of the sub-problems, propose two solutions based on the information from the lesson and your additional research. In the rationale column, explain how your solution restores the stability and biodiversity of your selected ecosystem. Sub-Problem Proposed Solutions Rationale Section 4: Answer the following analysis questions about your proposed solutions. Describe the ways your proposed solutions decrease the negative effects of habitat destruction and human activity on your selected ecosystem. Describe the costs, safety, and reliability of your proposed solutions, as well as any social, cultural, and environmental impacts your solutions address. Evaluate your proposed solutions for their impact on overall environmental stability and changes. Which solution has more impact? Explain your reasoning for picking one solution over another. How could you refine one of your proposed solutions to further reduce environmental impact and loss of biodiversity while also addressing human needs?
Answer:
the screen shot is the answers when you select kitakami River region
Explanation:
sorry this isn't the full answer this is all have myself at the moment.
Answer:
Explanation:
the links are images of the answers
Define concentration gradient.
Answer:
A concentration gradient occurs when the concentration of particles is higher in one area than another. In passive transport, particles will diffuse down a concentration gradient, from areas of higher concentration to areas of lower concentration, until they are evenly spaced.
Which of the following is NOT a function of the skeletal system?
A, Providing a framework for muscles
B. Creating new blood cells
C. Fighting disease
Answer:
From help from another user my answer was wrong to begin with the answer is C.
Explanation:
Most blood cells are created in bone marrow, the spongy substance found inside the bone structure.
B is a function of the skeletal system
The bones make the frame work of the body which allows us to stand and keep structure instead of being like slime.
A is a function of the skeletal system
ONCE AGAIN: The correct answer is C
two features of indirect democracy
Answer:
trump
Explanation:
what is meant by locomotor skill
Answer:
Body moving from one place to another in a vertical plane. Develop bodily control. Walking, running, leaping, jumping, hopping, galloping, sliding, & skipping.
Explanation:
Energy is converted from glucose, in the presence of oxygen, into numerous ATP molecules during
Answer:
Cellular respiration
Explanation:
how does the nervous system send messages to the other parts of the body
Answer:
by signals that the nervous system sends to the brain
Explanation:
Cookware companies have been using a chemical called C-8, which helps to create a nonstick coating to pans. However, the Environmental Protection Agency (EPA) recently claimed that the use of C-8 in the manufacturing of nonstick cookware should be discontinued because studies show it causes cancer.
Who might benefit financially the most from the EPA’s claim?
Answer:
Explanation:
The choices provided are:
a.restaurants that use C-8-coated cookware
b.cookware manufacturers who make pans out of steel only
c.stores that sell C-8 nonstick cookware
d.individuals who use steel cookware at home
From these choices B is the correct answer.
Restaurants that use C-8 cookware will not profit from using it but will need to lose money by replacing the old C-8 coated cookware.
Stores that sell this nonstick cookware will also need to replace their inventory so they won't be making extra money, only losing it.
And individuals at home will still be using steel cookware and won't benefit or lose anything by this change with the regulations of the c-8 coated nonstick cookware.
Will mark brainliest!
Please answer both questions will give extra points!!!
Please answer them in complete sentences same with the picture above :)
Question 1) Where did you get your chromosomes from? How many do you have ?
Answer: 1. Chromosomes come in matching pairs, one from each parent.
You have a total of 46 chromosomes 23 from mom and 23 from dad.
2. Yes, because chromosomes come from parents so in this case yes.
Explanation:
Cellular respiration refers to _____.
A releasing cellular energy through secretion
B the synthesis of cellular materials
C breathing
D the breakdown of sugar molecules in food to release energy
Answer:
D
Explanation:
Cellular respiration is a set of metabolic reactions and processes that take place in the cells of organisms to convert chemical energy from oxygen molecules or nutrients into adenosine triphosphate (ATP), and then release waste products.
Answer:
D. The breakdown of sugar molecules in food to release energy.
Explanation:
Cellular respiration is converting the glucose in your food to ATP in the mitochondria of the cell to produce energy for living.
Ricin is a chemical that has the effect of blocking eukaryotic ribosomes from performing translation. Why is this a dangerous chemical?
Answer:
if the ribosomes can’t perform translation, the human won’t be able to perform synthesis. this will kill the eukaryotic organism.
Explanation:
Global climate has changed in the past due to 1. __ and 2. __
1- air pollution
Earthquakes
Or plate tectonics
2- milankovitch cycles
Lunar phases
Or global warming
Answer: I think its air pollution and Global warming
Explanation:
Answer:
The answer is actually 1. plate tectonics and 2. Milankovitch cycles.
Explanation:
I got this correct on odyssey
Please help me idk if it’s right
Answer:
Yeah I think you are good.
Explanation:
You followed basic gene rules, it should work
Which of the following is an example of incomplete dominance
What happens to the amount of free water when you add salt to water
Answer:
it mixes i think lol
Explanation:
Smalles to greatest
Answer: cells, tissues, organs, organ systems, organism
Explanation:
PLEASE HELP AND THANK YOU!!!
Think about the factors that will influence the evolution of humans in the future. Name one factor that would exert influence through the process of natural selection and one factor that would exert influence through artificial selection.
A. natural selection: genetic engineering; artificial selection: demands placed on the brain
B. natural selection: individual mating choice; artificial selection: diseases
C. natural selection: diseases; artificial selection: genetic engineering
D. natural selection: demands placed on the brain; artificial selection: diseases
Part C
Projected values are only estimates. Can you think of either a natural or artificial factor that could increase or decrease the actual amount of wind energy the United States produces in the future?
Edmentum sample explanation:
Technological advancements in the future could lead to the production of higher-efficiency turbines, which could generate more electricity than originally predicted. Climate changes over time could affect wind speeds in a region, leading to higher or lower energy production.
The factors that would exert influence through the process of natural selection are a natural selection: diseases; artificial selection: and genetic engineering. The correct option is C.
What is natural selection?The strongest survive through natural selection, and the most favored traits endure through evolution. Natural selection is the result of selection pressure on a population's frequencies of a specific allele. Evolution is the process through which, over an extended period of time, new sets of naturally selected organisms emerged.
Future technological developments might result in the creation of turbines with a higher efficiency, which might produce more electricity than was initially anticipated. Wind speeds in a place may alter as the climate shifts through time, which could result in increased or decreased energy output.
Therefore, the correct option is C. natural selection: diseases; artificial selection: genetic engineering.
To learn more about natural selection, refer to the link:
https://brainly.com/question/14118238
#SPJ6
Which macromolecule and function are correctly matched? *
A. Lipids are used to build things like your hair, skin, nails, and muscles and are also
enzymes
B. Lipids are used for long term energy storage and carbohydrates are used for short
term energy storage.
C. Proteins and Lipids give us energy.
D. Carbohydrates contain your genetic information.
Answer: B. Lipids are used for long term energy storage and carbohydrates are used for short
term energy storage.
Explanation:
in which direction will air currents most likely move
A. from the land to the sea
B. straight up above the sea
C. from the sea to the land
D. straight down over the land
*****!!!! lots of points and brainliest!!!******** how do i find the codon and anti codon? :)
Answer:
The way to find a codon is by arranging the sequence of nitrogenous bases of the mRNA in groups of three, the triplets. Once the codon is found, the anticodon corresponds to a complementary triplet to that codon.
Explanation:
Codon corresponds to a triplet of mRNA nitrogen bases encoding an amino acid. Anticodon is responsible for carrying amino acids to the ribosome, according to the information of the mRNA, and the sequence of its triple must be complementary to that of the codon mRNA.
If, for example, a codon of the mRNA is AUG, its anticodon of the tRNA must be UAC, that is, complementary. Then, for the indicated exercises:
Exercise 1:
DNA ATACGAAATCGCGATCGCGGCGATTCGG mRNA UAUGCUUUAGCGCUAGCGCCGCUAAGCC CODON UAU|GCU|UUA|GCG|CUA|GCG|CCG|CUA|AGC|C- AntiCODON AUA|CGA|AAU|CGC|GAU|CGC|GGC|GAU|UCG|G- Amino acid Tyr|Ala|Leu|Ala|Leu|Ala|Pro|Leu|SerExercise 2:
DNA TTTACGGCCATCAGGCAATACTGG mRNA AAAUGCCGGUAGUCCGUUAUGACC CODON AAA|UGC|CGG|UAG|UCC|GUU|AUG|ACC AntiCODON UUU|ACG|GCC|AUC|AGG|CAA|UAC|UGG Amino acid Lys|Cys|Arg|Stop|Ser|Val|Met|Thr