Answer:
The cochlea is filled with two fluids (endolymph and perilymph), and inside the cochlea is the sensory receptor, the Organ of Corti, which contains hair cells, or the nerve receptors for hearing.
Have a good day
Mechanoreceptors are involved in hearing, which transmits the signals from external stimuli through mechanical ion-gated channels.
What is the structure of the ear?The organ of the Corti on the basilar membrane has hair cells that are involved in the sensory mechanism for hearing.
In the inner ear, there are six receptors (cochlea, two otolith organs, and three semicircular canals) which make a transduction unit consisting of hair cells.
In these receptors, external stimuli transmit the signal through the mechanically gated channel, external stimuli are touch, pressure, and hearing.
This processed signal to the brain by the neurons to hear the sound, and all the signal accumulate through the primary sensory receptors which are hair cells in the ear.
Therefore, mechanoreceptors are involved in hearing.
Learn more about sensory receptors, here:
https://brainly.com/question/17947146
#SPJ2
The given question is incomplete, so the most probable complete question is,
which sensory receptors are involved in hearing?(1 point) responses thermoreceptors thermoreceptors photoreceptors photoreceptors chemoreceptors chemoreceptors mechanoreceptors
what are the two classes of cells found in the human body
a) muscular and nervous
b) bone cells and endocrine cells
c) sex cells and somatic cells
d) permanent and temporary
Answer: the answer is c
Explanation:
Different types of cells occurs in organisms. These cells differentiate right from the zygote stage to become more specialized as the individual grow.
The two classes of cells found in the human body include the sex cells and somatic cells (option C).
These two main classes encompasses all the various types of specialized cells. The somatic cells are also called the body cells. These cells are diploid in nature. While the sex cells are also known as the gametes. The sex cells include the sperm cell from the male and the egg cell from the female. In humans there are 22 pairs of body cells (autosomes) and a pair of sex chromosomes (XX for females and XY for males).Learn more about the sex and body cells: https://brainly.com/question/927903
How does a new cell become specialized into a heart cell?
A new cell become specialized into a heart cell when its structure can be changed into a heart cell.
When the cell become specialized into heart cell by changing its structure, it will be able to do the function properly. Cell differentiation is that process in which cells become specialized into different types of cells such as heart cell, liver cell etc. A stem cell is an unspecialized cell that change into specialized cells under specific conditions which force the unspecialized cell into specialized cell.
When the heart needs more cells then the stem cells start converting into heart cells by changing its form and structure. These specialized cells go to the place where they are needed the most and start their work so we can conclude that new cell become specialized into a heart cell by changing its structure.
Learn more: https://brainly.com/question/19209945
Which device was not invented in the early 1900s?
Question 7 options:
A)
Electric vacuum cleaner
B)
Electric refrigerator
C)
Electric toaster
D)
Electric car
Explanation:
Electric Vacuum cleaner- 1901
Electric Toaster- 1893
Electric refrigerator- 1913
Electric car - 1884
Answer: Electric Car
Briefly explain how each layer interacts with electromagnetic radiation from the sun by describing the temperature changes that occur
Explanation:
The layers of atmosphere are differentiated on the basis of different temperature gradients.Thus,different layers within the atmosphere are created.
Toposphere is heated from the ground. Thus, with increase in altitude temperature decreases.
In the stratosphere, temperature increases with altitude. The direct heat source for the stratosphere is the Sun. Air in the stratosphere is stable because warmer, less dense air sits over cooler, denser air.
In Mesosphere temperature decreases with altitude. Few gas molecules present in mesosphere absorb sun's radiation.The heat source is the stratosphere below. The mesosphere is extremely cold, especially at its top, about -90°C.
Thermosphere which also contains ionosphere.The density of molecules is so low in here that one gas molecule could easily go upto 1 km before it collides with another molecule. It is so little energy is transferred, the air feels very cold
CLICK HERE PLEASE HELP
Answer:
step 3
Explanation:
Modules Why are fossils an important piece of evidence for evolution? Collaborations?
Answer:
they are inportant because they show us how the animal evolved,why, and when. also they gie us clues about modern day animals
Explanation:
15.Which of the following contain the genetic code? (Choose one: carbohydrates, nucleic acids, proteins).
16.Which of the following provide the most readily available energy? (Choose one: carbohydrates, lipids, nucleic acids, proteins).
Answer:
Protiens
Explanation:
because the DNA or RNA is translatted to sequence.
Imagine you were going to model the flow of energy in an ecosystem and the flow of elements in the ecosystem using a diagram
Compare and contrast your diagrams for these two systems.
Answer:
Only 10 percent of energy is transferred from one trophic to another while the elements transfer are proteins, carbohydrates and fats.
Explanation:
The flow of energy occurs in an ecosystem through a number of trophic. From the first trophic level to the second trophic level only 10 percent of energy is transferred while the rest of the energy is released in the form of heat energy. Flow of elements in the ecosystem refers to the elements that are essential for the survival of organism. These elements are present inside the foods which is eaten by these animals. Proteins, carbohydrates and fats are the elements transfer from one organism to another by eating the food.
a 1000 kg car speeds up from rest to 25 m/s in 10 seconds.how much force acts on the car?
Answer:
a great week to week to week to week I was
Explanation:
yhbbljgh
Some grass species use the C3 photosynthetic pathway and other grass species use the C4 photosynthetic pathway. As you move from North Dakota to Texas, explain why you think the percentage of grass species using the C4 photosynthetic pathway would increase, decrease, or stay the same.
Answer:
would increase
Explanation:
C3 plants are those where the first carbon compound produced during photosynthesis have three carbon atoms per molecule (instead of 4 in C4 plants). While higher is temperature and light, oxygen (O2) exhibits a higher affinity for Rubisco, a key enzyme in photosynthesis. In environmental conditions with high temperatures and light such as, for example, Texas when this state is compared to North Dakota, C4 plants tend to be more productive than C3 plants (because these plants have different metabolic pathways). Thus, it is expected that the percentage of C4 plant species in the local grass flora increases as latitude decreases.
It should be noted that the percentage of grass species using the C4 photosynthetic pathway would increase.
It should be noted that C3 plants simply refer to those where the first carbon compound produced during photosynthesis has three carbon atoms per molecule rather than the four carbon atoms that are in C4 plants.
In environments with high temperatures and light such as Texas when this state is compared to North Dakota, C4 plants tend to be more productive than C3 plants. Therefore, it is expected that the percentage of C4 plant species in the local grass flora will increase when there is a reduction in latitude.
Read related link on:
https://brainly.com/question/18766174
can someone draw this for me and add the labels please thank you I suck at drawing
Answer:
Explanation:
sure, when is it due
In gel electrophoresis, fragments are separated by size and electrical charge by applying __________ to them
Answer:
Gel matrix
Explanation:
Gel electrophoresis is a technique in molecular biology used to separate fragments of biomolecules such as DNA, RNA, protein by applying electric current through a GEL medium. The basis of separation of this fragments is their sizes and electrical charge.
In the gel electrophoresis procedure, a GEL medium made of Agarose is used. The DNA fragments, which are then negatively charged begins to move towards the positive end of the gel when electric current is supplied. The smaller fragments move/migrate faster than the larger ones towards the positive end. Therefore, In gel electrophoresis, fragments are separated by size and electrical charge by applying GEL to them.
Can someone find an example of mutualism in this passage? Please help I wasted all my points :)
Answer:
the coral and the algae
Explanation:
they both get positive things out of this so this is mutualism
The following DNA is being replicated and the origin of replication is in the middle of the sequence and marked with three stars ***.
5'ATCGGGCTACCCATGAAATGCTAGCATT***TAAGATCTTAAGCTAGCTAGTTCGATCTGA3'
What is the sequence of the primer for the LEADING strand? Your answer should be 8 nucleotides long, written from 5' to 3' and only include the nucleic acid sequence (ex: ACTACTAC).
note: there are two answers for this question
Answer:
5'GATCGTAA3'
5'ATTCTAGA3'
Explanation:
As requested in the question above, the primers were presented with 8 nucleotides, with the nitrogenous bases of the DNA, and in the 5'-3 'direction.
Primers are small fragments of DNA that are used by DNA polymerase to form new strands. The primes attach to pieces on the ribbon, through the complementarity of the nitrogenous bases, serving as a template for the DNA polymerase to create the new ribbon.
DNA polymerase uses primers at the origin of replication, and can follow the path from the right or from the left, depending on the primers used, for this reason, this question has two answers.
are unsaturated fats less healthy than saturated fats
If you do a Gram-stained on a bacteria isolated from a healthy human intestine you will find mostly Gram positive spiral cells.
Select one
True
False
I can help you:)
Most bacteria can be stained with postitevly charged stains.So this is true .My friend had a test about this so he told me all about this topic and helped me learn about it and help you.
so there you go :)
The internal urethral sphincter is comprised of
Answer:
1) the internal urethral sphincter (IUS), which consists of smooth muscle and is continuous with the detrusor muscle and under involuntary control, and 2) the external urethral sphincter (EUS), which is made up of striated muscle and is under voluntary control.
Explanation:
Hope this helped!
What type of electricity ended up being the one we use in homes?
Question 5 options:
A)
DC
B)
AC
C)
Static
D)
Intra-atomic
Answer:
b
becaus3 tjfjrjfjr tjrjdjdne fjdjd
A student will measure and record the growth (in height) of two flowering plants every other day for 20 days. Each plant will receive 200mL of water each day, but only one plant will receive 10mL of fertilizer. whats the independent variable, dependant variable, and the standardized variable?
Answer:
The correct answer is -
the independent variable - if fertilizer added or not,
the dependant variable - the height of the plant and
the standardized variable - 200ml water
Explanation:
In this study, the student wanted to see the effect of the fertilizer on the growth of the plant so the independent variable is the treatment of the fertilizer as manipulated or the independent variable is the factor which is affected or changed purposely during an experiment while other variables remain constant.
The dependent variable is the factor that is based or depends on the independent variable and measured to see the effect which is the height of the plants in this case.
The standardized or the control variable is the variable that remains constant throughout the experiment, 200 ml water treatment is the control variable in this experiment.
Glycolysis joins glucose to other molecules to make pyruvate. True or false
Answer:
false
Explanation:
The given statement about glycolysis that it joins glucose to other molecules to make pyruvate is a false statement as glycolysis is a catabolic reaction for glucose molecules.
Glycolysis is the first stage or process of cellular respiration in which -
one glucose molecule is broken down and two molecules of pyruvate are generated.Four ATP molecules also generate, however, two ATP molecules are used, therefore, a net gain of two ATP molecules.It is the fundamental process that takes place in both aerobic and anaerobic (lactate formed instead of pyruvate) cellular respiration.summary of glycolysisC₆[tex]H_{12}[/tex]O₆ + 2ADP + 2Pi + 2NAD⁺ → 2C₃H₄O₃ + 2H₂O + 2ATP + 2NADH + 2H⁺
On the basis of the given explanation, it is evident that the given statement is a false statement.
Learn more about glycolysis:
https://brainly.com/question/10886602
The nutrient needed for growth and repair of body tissues is
carbohydrate
protein
mineral
Answer:
Protein is a nutrient used to make and repair our body cells (like blood and muscle cells). About 1/2 of your dry body weight is protein. If you do not eat enough carbohydrates, protein will be changed to carbohydrates so that you can get energy.
Answer:
protein
Explanation:
Suppose that the narrow‑sense heritability of ear length in Reno rabbits is 0.4. The phenotypic variance (VP) is 0.5, and the environmental variance (VE) is 0.1. Calculate the additive genetic variance (VA) for ear length in these rabbits.
Answer:
0.20
Explanation:
The narrow-sense heritability, denoted by h², refers to the ratio of additive genetic variance (Va) to the total phenotypic variance (Vp).
Mathematically, it can be written as:
h² = V(A)/V(P)
Where;
V(A) = additive genetic variance
V(P) = total phenotypic variance
V(A) = V(P) × h²
Based on the information provided in the question, V(P) = 0.5, h² = 0.4
V(A) = 0.5 × 0.4
V(A) = 0.20
The additive genetic variance (VA) for ear length in these rabbits is 0.2.
If cells were a school building, the cell membrane would most likely be represented by which of the following?
А
intercom
B
lockers
С
teachers and students
D
walls and doors
In which structure would you expect to find a chloroplast?
A. Blood cell from a dog
B. Cell from sunflower leaf
C. Human skin cell
D. Liver cell from a penguin
Answer:
b.cell from a sunflower leaf
The structure that can have chloroplast is the cell from sunflower leaf. The correct option is B.
What is chloroplast?Chloroplasts are chlorophyll-containing organelles found in plant cells; they are necessary for Earth life because photosynthesis occurs in chloroplasts.
Proplastids give rise to chloroplasts, as do chromoplasts, leucoplasts, as well as other plastids.
Chloroplasts are plant cell organelles that use photosynthetic energy to convert light energy into reasonably stable chemical energy.
They survive life on Earth by doing so. Chloroplasts also perform a variety of metabolic functions for plant cells, such as the generation of fatty acids and membrane lipids.
Chloroplasts are found in all green plants and algae. Chloroplasts can also be found in photosynthesis that don't appear green, such as giant kelp's brown blades or certain plants' red leaves.
Thus, the correct option is B.
For more details regarding chloroplast, visit:
https://brainly.com/question/11136550
#SPJ6
What are the ways oxygen is transported in the blood, ranked according to the way that is responsible for the majority of transport of oxygen?
a. 1-dissolved in plasma, 2- Hb
b. 1-Hb, 2-HCO3, 3-dissolved in plasma
c. 1- dissolved in plasma, 2-Hb, 3-HCO3
d. 1-dissolved in plasma, 2-HCO3, 3-Hb
e. 1-HCO3, 2-Hb, 3-dissovled in plasma
f. 1- Hb, 2-dissolved in plasma
Answer:
f. 1- Hb; 2- dissolved in plasma
Explanation:
Transport of oxygen in the body occurs in two way; oxygen bound to hemoglobin and oxygen dissolved in plasma.
1. Bound to hemoglobin :
Hemoglobin, or Hb, is a protein molecule found in red blood cells and is responsible for the colour of red blood cells. It is composed of four subunits of two types of the protein globin: two alpha subunits and two beta subunits. Each subunit surrounds a central heme group (red in color) that can bind one oxygen molecule.Therefore, each hemoglobin molecule can bind and transport four oxygen molecules. About 98.5% of oxygen is transported in the body bound to hemoglobin.
2. Oxygen is only fairly soluble in blood plasma. As a result, only 1.5 percent of oxygen in the blood is dissolved and transported in blood plasma.
Increased numbers of CAG repeats in the exon of a gene is associated with certain diseases. In a specific gene, the existing CAG codons are in the 'zero' reading frame, in- frame with the AUG initiation codon. The effect of increased numbers of CAG repeats on the encoded protein is:___________. a. to silence of the gene to generate a truncated protein b. to generate a protein with a run of consecutive glutamines c. to generate a frameshifted protein product d. none of the above
Answer:
The correct answer is - option b. to generate a protein with a run of consecutive glutamines.
Explanation:
The initiation code AUG is the code for methionine and as well as the initiation code for the particular protein or peptide chain. In this protein, there is a repeat of CAG is increased with the initiation code so, even though they are in zero reading frame they code for their amino acid which is glutamine.
So. an increased number of CAG repeats will result in a protein with the a run of consecutive glutamines.
Help please I am begging I am stupid :(
Answer:
Explanation: b
Answer: if you need help get help
Explanation: help is like geting more egication and speed classes
have a nice rest of your day
production of oxygen during photosynthesis
Answer:
c
Explanation:
What are the major causes for moving air masses in North America
Answer:
Air masses build when the air stagnates over a region for several days/weeks. To move these huge regions of air, the weather pattern needs to change to allow the air mass to move. One major influence of air mass movement is the upper level winds such as the upper level winds associated with the jet stream.
Explanation:
A major cause for moving air masses in North America is the upper-level winds.
An air mass refers to a large body of air that has identical conditions throughout. It should be noted that air masses take on the condition of the area where they're formed.
Air masses move due to winds and air currents. Moving air masses bring about changes in the weather. The air masses in North America include maritime polar, continental tropical, continental arctic, etc. A major cause for moving air masses in North America is the upper-level winds such as the one that's associated with the jet stream.
Read related link on:
https://brainly.com/question/19087228
If the process illustrated in the diagram is interrupted by a chemical at point X, there would be an immediate effect on the release of
1) Chlorophyll
(2) carbon dioxide gas
(3) nitrogen gas
(4) oxygen gas
Answer: oxygen
Explanation:
If the process illustrated in the diagram is interrupted by a chemical at point X, there would be an immediate effect on the release of oxygen gas.
What is chloroplast?Photosynthesis, the process by which light energy is transformed to chemical energy and results in the generation of oxygen and energy-rich organic compounds, takes place in the chloroplast, a structure found inside the cells of plants and green algae.
Close relatives of chloroplasts that are free-living are photosynthetic cyanobacteria; according to the endosymbiotic theory, these organisms are the ancestors of both chloroplasts and mitochondria, which are eukaryotic cells' energy-producing organelles.
Therefore, If the process illustrated in the diagram is interrupted by a chemical at point X, there would be an immediate effect on the release of oxygen gas.
To learn more about chloroplast, refer to the link:
https://brainly.com/question/11136550
#SPJ2