х- 1, 2, 3 ,4
y-20, 18,-7, -2.
James modeled the data with a linear best-fit equation. Which X-value
has the largest residual?
A 1
B. 2
C. 3
D. 4​

Answers

Answer 1
I think it’s C, good luck

Related Questions

PLEASE HELP. BRAINLIEST.

Answers

Answer:

potter math 9 3/4

Step-by-step explanation:

malfoy

Enter the missing numbers in the table to show the proportional relationship:

Answers

165, 275, 8 sorry if im wrong

what is the term to term rule for this sequence 64 32 16 8 4

Answers

Answer:

Divide by 2 each time.

Step-by-step explanation:

The rule is dividing by 2 each time.

64/2=32

32/2=16

16/2=8

8/2=4

Hope this helps you!! Have an amazing day, and happy thanksgiving ^^

which equation is tru when the value of x is 3.5?

a. 2x - 8= 11
b. 2-4x=11
c. 13 - 2x = 38.5
d. x/4 + 9 = 23

Answers

none of the equations are true they are all false when you plug in 3.5 for x

3 < y ⩽ 7 where y is an integer Write down all the possible values of y

Answers

add 4 i guess. i dont really know

Answer: 4, 5, 6, 7

Step-by-step explanation:

Let’s break this apart into 3 < y and y <= 7.

We can rewrite 3 < y as y > 3, and we also have that y <= 7.

This is equivalent to the verbal expression y is greater than 3 and less than or equal to 7.

We can then conclude that y must be between 4 (since that is the first number greater than 3) and 7 (since y includes 7).

Therefore, y can be 4, 5, 6, or 7!

Hope this helps! :)

what is 4y = 3(x - 22) written in standard form
please help quick

Answers

Answer:

-3x+4y=- 66

Step-by-step explanation:

The first step is to multiply 3 by x and - 22. Should be 3x and -66

Now plug in the numbers.

4y = 3x - 66

Secondly, bring the 3x over to the left.

You get

-3x + 4y = -66

What are the slope and the y-intercept of the linear function that is represented by the table?

Answers

Step-by-step explanation:

I refuse to answer lol

help, stuck on the question

Answers

Answer:

the hash marks note that opposite sides are congruent.

the right angle notation implies that all angles are 90 degrees and are congruent as well

Answer:

All angles are congruent

Diagonals bisect each other

Diagonals bisect all angle

Opposites sides are congruent

Opposites sides are parallel

What is the product of StartFraction 4 Over 9 EndFraction and StartFraction 1 Over 11 EndFraction? StartFraction 4 Over 99 EndFraction StartFraction 5 Over 99 EndFraction StartFraction 9 Over 44 EndFraction One-fourth

Answers

Answer:

4/24

Step-by-step explanation:

Because 1/6 is 4/24 simplified.

To prove this, all you have to do is try simplifying 4/24 yourself. To do that, we are going to use 4 to divide both the numerator and the denominator because 4 is a common factor of 4 and 24.

(To simplify a fraction, you divide both the numerator and denominator by a common factor)

So 4 divided by 4 is 1, and 24 divided by 4 is 6

1/6

There were 400 sweets in a pack. The principal of a school bought 25 such packs of sweets for 2000 children o Children's Day. If each child was given 7 sweets, how many more packs of sweets were needed?

Answers

Answer:

10 more packs

Step-by-step explanation:

400 sweets bought 25 such packs = 400*25=10000

2000 each one gets 7 = 2000*7=14000

14000-10000=4000

4000/400 is 10.

So 10 more packs.

Hit the crown :D

Answer:

Step-by-step explanation:

400 sweets in a pack * 25 packs = 10,000 sweets

2000 kids * 7 sweets = 14,000

We need 4,000 more sweets. That would be 10 packs more  since there are 400 sweets in a pack.

Need help badly........

Answers

Answer:

1.) f(x)= 6x^5+2x^3-3x+1

Degree: 5

Leading coefficient: 6

Leading term: −6x^5

2.) f(x)= 7x^4+2x^3-3x+1

Degree: 4

Leading coefficient: 7

Leading term: 7x^4

3.) f(x)= -5x^3+2x-1

Degree: 3

Leading coefficient: -5

Leading term: 5x^3

these 2 questions ASAP!! BRAINLIEST & 30 points!!

Answers

Answer:

1.) 2/5

2.) -7/5

Step-by-step explanation:

Slope Formula: m = y2 - y1/x2 - x1

1.) 2/5

m = y2 - y1/x2 - x1

m = -1 - (-3)/0 - (-5)

m = -1 + 3/0 + 5

m = 2/5

2.) -7/5

(-2,3) and (3,-4)

m = y2 - y1/x2 - x1

m = -4 - 3/3 - (-2)

m = -4 - 3/3 + 2

m = -7/5

HELP PLEASE DUE IN 5M I NEED:

Keri's Percentage
Matthew's Percentage
Liam's Percentage
Who got the highest Percentage of Hits
Who got lowest percentage of Hits

I'll give brainliest​

Answers

Keri= 13/32x100/1=40.6%
Mathew=15/43x100/1=34.8%
Liam=12/28=3/7x100/1=42.86%
Highest=Liam
Lowest=Matthew

please help me!!! :)

Answers

I would assume that the angle of f equals 50°... sincesince the triangles are similar that means that the angles are most likely equal to each other. since the big triangle you can do it 90 + 40 which equals 130 then 180, since that is the total degrees in a triangle, minus 130 equals 50 this means 50 ° is the angle of c. keep in mind angle c equals angle f.

Can you find the slope-intercept of the line? Thank you!

Answers

Answer:

y = x + 2

Step-by-step explanation:

The equation of a line in slope- intercept form is

y = mx + c ( m is the slope and c the y- intercept )

Calculate m using the slope formula

m = [tex]\frac{y_{2}-y_{1} }{x_{2}-x_{1} }[/tex]

with (x₁, y₁ ) = (- 2, 0) and (x₂, y₂ ) = (0, 2) ← 2 points on the line

m = [tex]\frac{2-0}{0+2}[/tex] = [tex]\frac{2}{2}[/tex] = 1

The line crosses the y- axis at (0, 2) ⇒ c = 2

y = x + 2 ← equation of line

A large male giraffe needs to eat at least 75 pounds of food each day. At each feeding, the giraffe is fed 3 pounds of food. The giraffe has already consumed 24 pounds of food. How many more times x does the giraffe need to be fed? Write your answer as an inequality.

Answers

Answer:

0, hes getting too fat.

Step-by-step explanation: Dam-n fat bast-ard.

Answer:

x greater than or equal to 17

Step-by-step explanation:

75 - 24 = 51 pounds needed

3 × 17 =51

An EPA contractor needs to test the concentration of a substance in ten samples of the ground water. Seventy samples were


already collected from a single source over the course of a week at regular intervals. The contractor wants to test samples


evenly over the course of that time frame.

Answers

Answer:

Systematic sampling

Step-by-step explanation:

An EPA contractor needing to test the concentration of a substance in ten samples out seventy samples provided form a single source at regular time intervals.

For the contractor to effectively carry out the testing he has to employ a Non-probability system of sampling which is called Systematic sampling, because in systematic sampling we can assume the population size (x ) which in this case is 70 and the sample size( n ) to be 10

He will have to select ;  ( x / n )^th of the sampling frame for best results

Annie wants to make several plates of apples and apricots, so that each plate has the same number of apples and the same number of apricots. At most, how many plates can she make, if she is going to use 8 apples and 20 apricots.

At most, 8 apples and apricots can be arranged at ___ plates, so that each plate contains ___ and ___ apricots.

Please help! I need help filling in the blanks.

Answers

6 , 9 , 69 to the decimal reception apricot

Answer:

At most, 8 apples and apricots can be arranged at 4 plates, so that each plate contains 2 apples and 5 apricots.

Step-by-step explanation:

they are asking for the GREATEST amount of plates, but there are less apples than apricots so we must find the GCF, which is 4. then you divide the amount of apples by 4 as well as the amount of apricots by 4.

hope this helped :D

The Articles of Confederation created a weak central government. The Confederation Congress had the power to manage wars and deal with foreign countries, but it could not collect taxes or control the states. Check Your Understanding- Question 2 of 2 Attempt 1 of 2 How did states vote in the Confederation Congress? O A. Each state sent several representatives to the Congress but had only one vote. B. States were given votes in the Congress based on the size of their population. C. Each state sent two representatives to the Congress, and both representatives could vote.​

Answers

the answer is get a life

Hi again I need a story that matches the equation -6 + 3x = 2 + 4x

Answers

Answer:

A.

Step-by-step explanation:

The required stories that are models of the given expression  -6 + 3x = 2 + 4x are given in A and B. Both options are correct.

What are equation models?

The equation model is defined as the model of the given situation in the form of an equation using variables and constants.

Option A,

At 5 p.m., the temperatures recorded at two weather stations in Antarctica are -6 degrees and 2 degrees. The temperature changes at the same constant rate, x degrees per hour, throughout the night at both locations. The temperature at the first station 3 hours after this recording is the same as the temperature at the second station 4 hours after this recording.

So from the above statement,
The equation modeled is given as
-6 + 3x = 2 + 4x

The above expression is equivalent to the given statement. So story mentioned in option A matches the given equation.

Similarly,
The equation formed in Option B also matches the given equation.

Thus, both options are correct.

Learn more about models here:

https://brainly.com/question/22591166

#SPJ5

Solve for x.
x/3+y=2x+19

Answers

Answer:

The answer is [attached photo].

Hope this helps and if you could mark this as brainliest. Thanks!

Answer:

(3+y)-19=x

Step-by-step explanation:

x/3+y=2x+19

=3+y=2x-x+19

(3+y)-19=x

Find the center and radius of the equation of the circle
a). x2 + y2 – 8x +6y + 9 = 0​

Answers

Compare the given equation with the general equation of a circle

Given equation: x² + y² - 8x +6y +9 = 0

Equation of a circle: x² + y² + 2gx + 2fy + c = 0

2g= -8; g = -8÷2= -4

2f = 6; f = 6÷2 = 3

c= 9

Solving for radius of the circle...

r =√g² + f² - c

g= -4, g² = ±16

f = 3, f² = 9

Substituting, we have

r = √16 + 9 - 9

r = √25-9

r=√16

r = 4

Therefore, the centre and radius of the circle is 9 and 4 respectively.

Hope this helped!

Please mark brainliest;-)

plz help me its do today

Answers

Answer:

your doing slope too?

Step-by-step explanation:

bro im doing that rn

Answer:

Slope: 1

Y intercept: 2 or (0,2)

Equation: y=x-2

Step-by-step explanation:

11. Alicia and three friends are making a video

to post online. The three friends all made

video segments of equal length, and Alicia's

video segment is less than 5 minutes long.

Let s represent the length of each of the

friend's segments. Write an inequality to

represent the length l of the full video.

Al> 3s + 5 © e> 3s + 5

Be<3s + 5 D &< 35 +5

Answers

Answer:

L < 3s + 5

Step-by-step explanation:

Given that:

Video length of all 3 friend are equal

Let the length of the video made by each friend = s

Length of video of all 3 friends = 3s

Alicia's video segment is less than 5 minutes long

Hence the length L of the full video :

L = (Length of video of all 3 friends + Alicia's video segment)

Since Alicia's < 5

Hence full video length :

L < 3s + 5


Need help please I’m begging yeah.

Answers

Answer: The answer is B.

The medieval spice merchant wants to blend some
garlic powder, which costs 38 cents per pound,
with 7 pounds of ground pepper, which costs 44
cents per pound, to create a big batch of medieval
smelling salt worth exactly 40 cents per pound.
How many pounds of the garlic powder should he
use?

Answers

Answer: I think the answer is two pounds

Step-by-step explanation:

Answer:

2 pounds

hope it helps

brain?

Step-by-step explanation:

Classify the following polynomials. Combine any like terms first
2-x² + 4x+x²
x – 5x²+3-2
x²-x²+x²-x²+3
7x-x² + x³+4x²
-6x-x² + 6x-4x

Answers

a. It is a binomial

b. It is a trinomial

c. It is a monomial

d. It is a trinomial

e. It is a binomial

To answer the question, we need to know what polynomials are

What are polynomials?

Polynomials are algebraic expressions that contains variables and coefficients.

a.

2 - x² + 4x + x² = 2 - x² + x² + 4x

= 2 - 0 + 4x

= 2 + 4x

Since it has two terms, it is a binomial

b.

x - 5x² + 3 - 2 = x - 5x² + 1

= - 5x² + x + 1

Since it has three terms, it is a trinomial

c.

x² - x² + x² - x² + 3 = 0 + 0 + 3

= 3.

Since this contains a single term, it is a monomial

d.

7x - x² + x³ + 4x² = x³ + 4x² - x² + 7x

= x³ + 3x² + 7x

Since it has three terms, it is a trinomial

e.

-6x - x² + 6x - 4x = -6x - x² + 2x

= - x² + 2x - 6x

= - x² - 4x

Since it has two terms, it is a binomial

a. It is a binomial

b. It is a trinomial

c. It is a monomial

d. It is a trinomial

e. It is a binomial

Learn more about polynomials here:

https://brainly.com/question/2833285

#SPJ1

EASY QUESTION
What is the greatest common factor of 18, 36, and 90?

Answers

18 will divide into both 36 and 90 , but so 18 is the GCF

Answer:

18

Step-by-step explanation:

HEEEEEEEEEEEEEEELLLLLLLPPPPP PLEASE

Answers

Answer:

3  1/5

Step-by-step explanation:

I used my calculator, but convert to the greatest common factor which is 15 and multiply, then simplify to 16/5 and turn to a proper fraction 3 1/5.

Answer:

=  16/5  =  3  1/5

Step-by-step explanation:

8,228.8165 divided by 0.528=?
Round your answer to the nearest thousandth.

Answers

Answer:

15584.880

Step-by-step explanation:

8,228.8165 divided by 0.528

= 15584.8797348

= 15584.880 (rounded to the nearest thousandth)

(Remember to keep the thousandth digit, even if it's 0)

Hope this helped!

Other Questions
i need help with this problem. This is the last giveaway for today!! if you could be any movie character who would you be? GIVING BRAINLIEST FOR WHO ANSWERS FIRST! Please help me answer 16 please What month did the October Revolution occur? what were the political limitations of african american during 1865-1900? one paragraph the sunshine Club collected 524 cans for a canned food drive. the cans were then split up equally into 8 boxes. Part A how many can were in each box? Part B how many can were left over after the boxes were filled? Helppp plzz!! A.) Side - Side - SideB.) Side - Angle - SideC.) Angle - Side - AngleD.) Angle - Angle - SideE.) Hypotenuse - LegF.) Not enough information. my picture please hahahahahahah Read the excerpt from The Dark Game: True Spy Stories from Invisible Ink to CIA Moles.Tension between the two sides escalated until June 1948, when the Soviets blocked all western access to the capital. In this first real crisis of the Cold War, the West was not going to be denied by the Soviets.If the underlined word were replaced with the word "event, the tone of the excerpt would bemore resentful.more intellectual.less intense.less objective. how might have the oppressive British rule influenced the ideas of the articles of confederation ? A collection of the same kind of cells working together to do the same job HELP PLEASE ASAP Read the excerpt from "On Becoming an Inventor" by Dean Kamen.When I was twelve years old and Barton, my older brother, was around fifteen, we took over the family basement. At first, I made a darkroom for developing pictures, and Bart was using it as his lab where he was raising about one hundred white rats, removing their thymus glands, and trying to figure out the glands' dysfunction. He wanted pictures taken of his experiment, doing the surgery on rats, and since I already had a darkroom, I took the pictures, though somewhat reluctantly. I didn't like the blood.What can you conclude about Barton from the excerpt?He was interested in solving medical mysteries at a rather early age.He did not understand why Dean would be squeamish about the blood.He went on to become a very famous and successful doctor.He had a severe dislike for rats and all other kinds of rodents. find the slope of the line passing through the points (-5,5) and (-5,-8) What is the unit rate of 232 people in 8 classrooms? i need help with this pleasee five men build a wall in 10 days how long will it take 10 men Anchara drops a penny from a height of 60 feet above the ground. The equation h=-16t^2 + 60 models the penbys height h i feet as a function of time t in seconds whatvare the solutions P3- is a(n) ______________________, so it ________________ valence electrons. Group of answ er choices anion, gained cation, gained cation, lost anion, lost The following DNA is being replicated and the origin of replication is in the middle of the sequence and marked with three stars ***. 5'ATCGGGCTACCCATGAAATGCTAGCATT***TAAGATCTTAAGCTAGCTAGTTCGATCTGA3'What is the sequence of the primer for the LEADING strand? Your answer should be 8 nucleotides long, written from 5' to 3' and only include the nucleic acid sequence (ex: ACTACTAC).note: there are two answers for this question