2. The envelope below has a mailing label. L(x) = 6x + 5 W(x) = 6x + 5 M(x) = x +4 NOx) = x + 2 MR. AL GEBRA 123 INFINITY WAY POLYNOMIAL, XY 11235 a. Let A(x) = L(x).W(X) - M(x)•N(x). Find A(x).​

2. The Envelope Below Has A Mailing Label. L(x) = 6x + 5 W(x) = 6x + 5 M(x) = X +4 NOx) = X + 2 MR. AL

Answers

Answer 1

Answer:

A(x) = 35x² + 54x + 17

Step-by-step explanation:

Relation in the polynomials has been defined as,

A(x) = L(x).W(x) - M(x).N(x)

L(x) = (6x + 5)

W(x) = (6x + 5)

M(x) = (x + 4)

N(x) = (x + 2)

By substituting the polynomials in the expression,

A(x) = (6x + 5)(6x + 5) - (x + 4)(x + 2)

      = (6x + 5)² - (x + 4)(x + 2)

      = (36x² + 60x + 25) - (x + 4)(x + 2) [Since, (a + b)² = a² + 2ab + b²]

      = (36x² + 60x + 25) - [x(x + 2) + 4(x + 2)]

      = (36x² + 60x + 25) - [x² + 2x + 4x + 8]

      = (36x² + 60x + 25) - [x² + 6x + 8]

      = (36x² - x²) + (60x - 6x) + (25 - 8)

      = 35x² + 54x + 17

A(x) = 35x² + 54x + 17


Related Questions

Stephanie wants to find out how much a visit to an amusement park will cost her. The amusement park charges a $20 admission fee, as well as $0.50 for each ride, r. The expression 0.50r + 20 represents this situation. Evaluate this expression when r = 15. Explain what this value means in terms of the context of Stephanie's visit to the amusement park.

Answers

Answer:

Step-by-step explanation:

0.50(15)+20=x

7.50+20=x

27.5=x

Therefore, x means how much the visit to the amusement park will cost her.

Write the equation of line
that has slope of 4 and
goes through the point 0-3

Answers

Answer:

                   y=4x-3

Step-by-step explanation:

500kg÷60 cm³
Answer =​

Answers

Answer:

Has something wrong with this question. Kg (Kilogram) is the weight value. And [tex]cm^{3}[/tex] (centimeter square 3) is length or distance value. We can't divide kg with [tex]Cm^{3}[/tex].

Step-by-step explanation:

A spider ate 25\%25%25, percent more bugs this month than last month. The spider ate 888 bugs last month.

Answers

Answer:

1110

Step-by-step explanation:

888*(1+25%)

=1110

PLS GIVE BRAINLEST

Answer:10

Step-by-step explanation:

The power, P (watts), of a car engine is proportional to the square of its speed, s(m/s) When s= 30 P= 1500 Work out the speed (to 1 DP) when the power is 1715 watts

Answers

Answer:

S = 32.1 m/s

Step-by-step explanation:

P = 1,500

S = 30

since P is proportional to S², then we must first determine S² = 900

900 / 1,500 = S² / 1,715

(900 x 1,715) / 1,500 = S²

1,543,500 / 1,500 = S²

S² = 1,029

S = √1,029 = 32.08 m/s ≈ 32.1 m/s

Suppose you loan $320 to a friend and charge them 11% annual interest. If they don't pay any back, how many years will it take for them to owe you $2,000? Round your answer to the nearest hundredth (2 places after the decimal).​

Answers

Step-by-step explanation:

For them to owe you a total of$2000 then an interest of $2000-320=$1680 must have accrued over the time T

T=$1680×100/320×11

T=47.7272...47.73 to the nearest hundredth

Proof,

Interest after 47.7262...years which is converted to 525/11 years

=($320×11×525/11)/100

=$1680

therefore total amount which will be owed at that time =principal+interest accrued

=$320+1680=$2000

Let a = ⟨5, –9⟩ and b = ⟨–3, 1⟩, and c = b – a. What is the magnitude and direction angle of c?

|c| = 12.8; θ = 128.7°
|c| = 18.0; θ = 128.7°
|c| = 12.8; θ = 308.7°
|c| = 18.0; θ = 308.7°

Answers

Answer:

A

Step-by-step explanation:

The magnitude and direction angle of c is 12.8 and 128.7° respectively.

What is the magnitude and direction of a point vector?

"A vector contains two types of information: a magnitude and a direction. The magnitude is the length of the vector while the direction tells us which way the vector points.

Vector direction can be given in various forms, but is most commonly denoted in degrees. Acceleration and velocity are examples of vectors."

Given: a = (5, –9) and b = (–3, 1) and c = b – a.

Therefore, c = (5+3, -9-1) = (8, -10)

Now, magnitude of c is [tex]\sqrt{8^{2}+(-10)^{2}}[/tex] = 12.8

The direction of c is Ф = tan⁻¹(-10/8) = -51.3°

Therefore, the direction of c is 180° - 51.3° = 128.7°  (tanФ = tan(π+Ф))

Learn more about magnitude and direction of a point here: https://brainly.com/question/11864438

#SPJ2

How many solutions exist for the given equation?
3(x + 10) + 6 = 3x + 12)

zero

one

two

infinitely many

Answers

It’s zero solutions

Answer:

theres no solution

Step-by-step explanation:

3x+36=3x+12 is not mathmatically correct no matter what x is

What is the answer for this math question?​

Answers

Answer:

Gn=A1 r(n/3)

Step-by-step explanation:

well since u just divide by three I think the answer is divide by 3.

Hope this helps Happy Thanksgiving :D    

I need help with the range

Answers

Answer:

[-9, 0]

Step-by-step explanation:

The range is the y values that the equation/line covers.

The line's lowest point is -9 and the line's highest point is 0. The values are defined (no open circle at the highest point) so we use brackets.

Solve: -9/10 + p = 1/5

Answers

Answer:

p=11/10

Step-by-step explanation:

Answer:

p=-55

Step-by-step explanation:

6(c+3) – 4(c + 4)

please help what is the answerrrrrrrr????

Answers

Answer:

Step-by-step explanation:

6c + 18-4c + 16

Solving like terms

2c + 34

Answer: 2c + 2

6(c + 3) - 4(c + 4)

= 6c + 18 - (4c + 16)

= 6c + 18 - 4c - 16

= 2c + 2

Step-by-step explanation:

At the Atlanta United game, a ball flew into the stands. A fan launches the ball at 19.6 feet per second (ft/s) from a 60 ft tall bleacher. The equation for the soccer ball's height, s, at time, t, seconds after the launch is s(t) = −4.9t2 + 19.6t +60. When does the ball hit the ground?

Answers

Answer:

6.03s

Step-by-step explanation:

Given the equation for the soccer ball's height, s, at time, t, seconds after the launch expressed as

s(t) = −4.9t2 + 19.6t +60

The ball hits the ground when s(t) = 0

Substitute s(t) = 0 into the expression

0= −4.9t2 + 19.6t +60

Multiply through by -10

0 = 49t²-196t-600

49t²-196t-600 = 0

Factorize

t = 196±√196²+4(600)(49)/2(49)

t = 196±√38416+117600/98

t = 196±√156016/98

t =196±394.99/98

t = 196+394.99/98

t = 590.99/98

t = 6.03secs

Hence the ball bit the ground after 6.03seconds later

help i need it badly

Answers

yeah same what you need help on tho
I think 2 because it just makes the most sense because 3+2 and there was a five on the other one

9 over n = 3over 4 solve for n​

Answers

Answer:

Step-by-step explanation:

9/n = 3/4                    Cross Multiply

3n = 36                      Divide by 3

n = 36/3

n = 12

A rectangular park is 40m long and 28m broad then find it's area​

Answers

Area of rectangle=length*breadth
So:
40*28=1120
*ANSWER*
1120

i dont know what this is i just know it requires work

Answers

Answer

1. 6x + 18 = 48

2. x/2 + 6 = 14

Step-by-step explanation:

1. Its 18 plus meaning + then 6$ per hour and we dont know how many hours so you put the X next to it!

2. First he sold half so but we dont know the starting number so we put x/2 then we have to add 6 and we get 16

Which function is increasing at the highest rate?

Answers

Answer:

D

-6y= -12x-24

/6          /6

change to slope intercept form: y=2x+4

slope is 2

Step-by-step explanation:

Answer:

D

Step-by-step explanation:

I REALLY HOPE THIS HELPS PLS CONSIDER GIVING BRAINLIEST I REALLY NEED IT AND WOULD APPRECIATE IT!

PLEASE ANSWER ASAP!!!!!!!Calculate the quotient below and give your answer in scientific notation.
0.00065
5 x 10-2
?

Answers

Answer:

Step-by-step explanation:

0.00065 ÷5*10^-2

0.00065 ÷ 0.05= 0.013

Given the points (4,3) and (2,6) what is the slope?

Answers

The slope is 1.5 i think

Solve For: 5x + 2 = 4x − 9

Answers

Answer:

Step-by-step explanation:

5x+2=4x-9  -4x from both sides

x+2=-9 take 2 from both sides

x= -11

Answer:

x = -11

Step-by-step explanation:

5x + 2 = 4x - 9

5x = 4x - 11

x = -11

Identify the terms, coefficients, and constants of the expression. a^2 + 2 + 7b

Answers

Step-by-step explanation:

constant=7

coefficient=2

Nicholas found the 13th term of the geometric sequence 15, 30, 60, 120 the following way:
A(13) = 15 * 213
A(13) = 15 * 8,192
A(13) = 122,880

Is Nicolas correct? Why or why not? (Make sure to justify your answer) If Nicolas is incorrect please state the correct solution.

Answers

Answer: No. Nicolas is wrong.

Step-by-step explanation:

The formula for calculating nth term of a geometric sequence is given as:

= ar^n-1.

where a = first term = 15

r = common ratio = 30/15 = 2

n = 13

Using the formula,

= ar^n-1

= 15 × 2^(13-1)

= 15 × 2^12

= 15 × 4096

= 61440

The 13th term is 61440. Nicolas is wrong.

Nathan is planning to ride his bike for 24 minutes. If he rides at a rate of 3 miles per hour, how far will he travel?

Answers

Answer:

1.2 miles in 24 minutes

Step-by-step explanation:

3 miles per hour = .05 miles per minute

24 x 0.05 = 1.2

Remember that speed is defined as the rate of change of the position respect to the time, thus we can define the relation:

Distance = Spee*Time.

Using this we will get the solution: distance = 1.2 miles

Let's see how to get the solution:

We start with the given information:

Nathan rides for 24 minutes.His speed is 3 miles per hour.

So we got a time and we also have a speed, but the time units in these are different.

So knowing that:

1 hour = 60 minutes

(1 hour/60 minutes) = 1

Then we can write:

24 minutes = (24 minutes)*(1 hour/60 minutes) = 0.4 hours

Then we have:

time = 0.4 hours

speed = 3 miles per hour.

Then, using the first equation, we get:

distance = (3 miles per hour)*0.4 hours = 1.2 miles.

If you want to learn more, you can read:

https://brainly.com/question/23774048

someone help simplify it

Answers

Answer:

a+11b/3

Step-by-step explanation:

Answer:

3 and 2/3b + 1a

Step-by-step explanation:

Simplifying b:

4b - 1/3b = 11/3b = 3 and 2/3b

Simplifying a:

-5a + 6a = 1a

Do I add all the cost up then divide by four?

Answers

Answer:

Yeh that's what you have to do.....

Divide the total amount by four

Answer:

yes

Step-by-step explanation:

You're given three angle measurements of 30°, 70°, and 80°. How many triangles can you construct using these measurements?
А О
B. 1
с 2 .
D. infinitely many

Answers

Answer:

I think b

bye have a great day

How do I solve 4x+23>-21

Answers

Answer:

Inequality Form:

x>-11

Step-by-step explanation:

Interval Notation:

(-11,\infty )

Answer:

Step-by-step explanation:

4x + 23 > -21

4x > -21 -23  (moving 23 to the right side of equation changes the +23 to  -23

4x > -44  (adding -21 to -23)

x > -11  (dividing both sides of equation by 4, this keeps the equation the same

Solution:  x > -11  (x is greater than negative 11)

A pickup truck carrying 10 to the power of 3 identical brick weighs 6770 pounds. If the empty truck weighs 6133 ​pounds, what is the weight of each brick?

Answers

Answer:

0.637 pounds per brick

Step-by-step explanation:

Given that:

A pickup truck carrying:

10³ identical brick weighs 6770 pounds

If the empty truck weighs  6133 pounds

The weight of each brick can be calculated as follows:

The weight of each brick = The weight of the full pick up truck - the weight of the empty truck

The weight of each brick = 6770 - 6133

The weight of each brick =  637

The pickup truck carrying 10³ identical brick = 1000 identical brick

Thus, the weight of each brick  = 637/10³

Thus, the weight of each brick  = 0.637 pounds per brick

interquartile range of the wingspans of 74, 71, 75, 80, 67, 84, 77

Answers

Answer: 9

Step-by-step explanation:

Population size=7

Lower quartile=71

Upper quartile=80

67 Is or es el 67

Jajaja

Other Questions
A collection of the same kind of cells working together to do the same job HELP PLEASE ASAP Read the excerpt from "On Becoming an Inventor" by Dean Kamen.When I was twelve years old and Barton, my older brother, was around fifteen, we took over the family basement. At first, I made a darkroom for developing pictures, and Bart was using it as his lab where he was raising about one hundred white rats, removing their thymus glands, and trying to figure out the glands' dysfunction. He wanted pictures taken of his experiment, doing the surgery on rats, and since I already had a darkroom, I took the pictures, though somewhat reluctantly. I didn't like the blood.What can you conclude about Barton from the excerpt?He was interested in solving medical mysteries at a rather early age.He did not understand why Dean would be squeamish about the blood.He went on to become a very famous and successful doctor.He had a severe dislike for rats and all other kinds of rodents. find the slope of the line passing through the points (-5,5) and (-5,-8) What is the unit rate of 232 people in 8 classrooms? i need help with this pleasee five men build a wall in 10 days how long will it take 10 men Anchara drops a penny from a height of 60 feet above the ground. The equation h=-16t^2 + 60 models the penbys height h i feet as a function of time t in seconds whatvare the solutions P3- is a(n) ______________________, so it ________________ valence electrons. Group of answ er choices anion, gained cation, gained cation, lost anion, lost The following DNA is being replicated and the origin of replication is in the middle of the sequence and marked with three stars ***. 5'ATCGGGCTACCCATGAAATGCTAGCATT***TAAGATCTTAAGCTAGCTAGTTCGATCTGA3'What is the sequence of the primer for the LEADING strand? Your answer should be 8 nucleotides long, written from 5' to 3' and only include the nucleic acid sequence (ex: ACTACTAC).note: there are two answers for this question A farmer's market is selling peaches for $2.00 a pound. If you buy 2 pounds, you save 10% on each pound. How much does it cost to get 2 pounds of peaches? 1. What right do education encompasses both entitlements and freedom?A. Right to free and compulsory primary educationB. Right the quality education in private schoolC. Right to choose yourteachersD. All of the above2. Which of the following is an example of non-formal education?A. Primary schoolingB. Senior high schoolC. Adult night classesD. Doctorate program El libro. _____ Libros. Approximately how many people are likely trafficked into the United States each year?5,5008,5008,50011,50011,500-14,500O 14,50017,500 She dove 75 feet under the sea To be eligible for Bright Futures, you must submit a statement explaining how all money will be repaid submit a plan of action for all courses throughout college take at least three remedial credits in the first semester take at least six non-remedial credits per semesterplease only answer if you know what your talking aboutand if your right i will give brainiest. What was the biggest drawback of Chinese block printing? In a perfectly insulated container of negligible mass, 4.00 102 kg of steam at 100C and atmospheric pressure is added to 0.200 kg of water at 50.0C. A) If no heat is lost to the surroundings, what is the final temperature of the system? B) At the final temperature, how many kilograms are there of steam and how many of liquid water? What is the importance of the Battle of Khanua and Chaunsa? VocabularyMake a sentence using these two wordsdedicated, obstaclecollaborate, techniques 3) Complete the sentences. Use the Past Simple or the Present Perfect Simple form of the verbs in brackets1 Marry_____(win) the lottery last year.2 I _____(not see) anyone yet.(come/just) home.4. They____(buy) the car two years ago5. William still____(not buy) the present for his sister 4 Complete the sentences. Use the Present Perfect Simple or the Present Perfect Continuous form of the verbs inbracts1. The baby's face is really dirty. What____(he/eat)?2. Like____(never/be) abroad3. Eva is exhausted these days. She______(work) too hard recently.4.______(you/finish) your homework yet?5. I_____(clean) all morning I'm really tired!