9. What was the outcome of the Clarksburg Convention?

Answers

Answer 1

Answer:

im so sorry but i couldnt find an answer for you sorry luv <3

Explanation:

ftyuikmnbvcfrtyuiop


Related Questions

what did England and France competed for the River Valley early on in the conflict.

Answers

Answer:

The French wanted to control the American Indian trade in the Ohio River Valley and keep the Pennsylvania traders out.

Explanation:

The war started because of conflict between England and France. They both wanted control over the Ohio River Valley. Both sides wanted the valley so they could expand their settlements into the area.

Which of these is NOT paired correctly?
a
b
"The Shadow" - Abbott and Costello
"It Happened One Night" - Clark Gable
"Gone with the Wind" - Vivien Leigh
"Wizard of Oz" - Judy Garland
d

Answers

Answer:

wizard of oz - judy garland

Which of the
following best
describes the
meaning of the
political cartoon?
A. Slaves are being helped.
B. The KKK is nonexistent.
C. Freed slaves are
intimidated
D. Southerners hated the
KKK.

Answers

Answer:

I think it is c

Explanation:

it makes the most seence

True or False? China is the top worldwide GDP leader.

Answers

Answer:

Should be false.

Explanation:

The US had over 20 trillion GDP, but China has a littler over 13 trillion.

How did enslaved people played a role in freeing themselves

Answers

Answer:

Steadily, as opportunities arose, slaves risked all for freedom by abandoning their owners, coming uninvited into Union lines and offering their help as laborers, pioneers, guides and spies. Slaves forced federal soldiers at the lowest level to recognize their importance to the Union's success.

yyaaaaaaaaaaaaaaaaaaa

Which is the MOST likely inference that can be drawn from the trend shown on the graph?
a.
There was little demand for workers in the United States between 1898 and 1914.
b.
There were no constitutional guarantees of religious freedom in the United States.
c.
Immigration to the United States was often discouraged between 1898 and 1914.
d.
Factory workers were in great demand in the United States between 1898 and 1914.

Answers

Answer:

i belive the anwser is d

Explanation:

Many factory workers had little to no pay checks during that time.

brainliest plz

What is the objective of the game monopoly

Answers

Answer:

Monopoly, real-estate board game for two to eight players, in which the player's goal is to remain financially solvent while forcing opponents into bankruptcy by buying and developing pieces of property.

Explanation:

Answer:

The object of the game is to own as much land (property) and to be the richest player.

Explanation:

Hope this helps. :)

Why do people need to worry about the negative environmental impacts of pipelines?

Answers

Answer:

Releases of products carried through pipelines can impact the environment and may result in injuries or fatalities as well as property damage. Crude oil spills can result in harm to human health and the wildlife health.

Explanation:

explain how the author of "the light at the end of the publishing tunnel" contrast the past with the present

Answers

Answer:

in this article the author contrasts the past and the present and indicates there are fewer readers now then there were in the past

Explanation:

why is the Kamikaze remembered

Answers

Answer:

Kamikaze is mostly remembered off of Japan's war tactic during World War Two which made pilots of the Kamikaze Corps to kill themselves by ramming planes into enemy targets (Mainly American Ships). The history of "Kamikaze" was the huge typhoon that had destroyed the Mongolian invaders twice. Kamikaze means "Divine Wind." It is not really known for the typhoon but as the WWII tactic that was used heavily.

3. Why do you think Galileo abjured?

Answers

Answer:

Their opinions were strongly argued in favour of the view that the Dialogue taught the Copernican theory. Galileo was found guilty, and the sentence of the Inquisition, issued on 22 June 1633, was in three essential parts: ... He was required to "abjure, curse, and detest" those opinions.

The New York State Tenement House act required new buildings to have ___________

Answers

Answer:

fire escapes for each suite and a window for every room

Explanation:

I'm not 100% sure if thats right but I think it is

Which statement describes how a constitutional amendment can be proposed?
A
They can be proposed by a two-thirds vote of the Senate.
B.
They can be proposed by a two-thirds vote of the Supreme Court.
C
They can be proposed by two-thirds vote of both houses of Congress.
D
They can be proposed by two-thirds vote of the House of Representatives.

Answers

Answer:

d. they can be proposed by two thirds vote of the house of representatives

Explanation:

me smart

Answer: they can be proposed by two thirds vote of the house of representatives

Explanation: imma pro

I need someone to fill this out for 6 different sections for the Martin Luther King Junior I have a dream speech please be fast

Answers

Answer:

The content of Dr. King’s speech, his inspiring presence, and the moment in history all came together to make the iconic “I Have A Dream” speech the defining moment of the American Civil Rights Movement. But there are several other reasons why this speech, delivered over 50 years ago, remains an example of one of the best speeches in American history.

Since part of my job is to help people become better presenters, I’ve noticed several techniques that we can all learn from and be inspired by in this magnificent speech.

IT’S ANCHORED IN A POWERFUL RELATED LOCATION

In most cases, you can’t handpick the spot to give a presentation, as MLK did for supreme symbolic effect when he stood on the steps of the Lincoln Memorial and echoed the opening words of the Gettysburg Address (“Five score years ago . . . ). But you absolutely can amplify your message by adapting it to your setting and location.

Think about place, and how you can weave imagery, anecdote, and historical context into your presentation. Even if you’re presenting essentially the same material in Annapolis and Anaheim, it’s worth exploring what inspiration you can draw from each location to make your overall presentation more unique, more tailored, and more memorable. Abraham Lincoln also incorporated context in his iconic speech.

Explanation:

16. Which of the Olympian gods did not spend much time on Mount Olympus?

Answers

Answer:

Posiden or Hades, Most likey Hades.

Explanation: Hades dwells in his own realm most of the time that being the underworld.

Which labor union had the greatest impact on the lives of workers

Answers

Answer:

The Knights

Explanation:

The Knights of Labor began as a secret society of tailors in Philadelphia in 1869. The organization grew slowly during the hard years of the 1870s, but worker militancy rose toward the end of the decade, especially after the great railroad strike of 1877, and the Knights’ membership rose with it.

your welcome

What does the artist of this cartoon hope Tsar Nicholas ii Will achieve?​

Answers

Explanation:

thanks for free point

Answer:

In the first decade of the twentieth century, Harper's Weekly began running a page of cartoons reprinted from daily newspapers from across the country and called "Events of the Week in Cartoons." This cartoon from the Philadelphia Inquirer depicts the cause of the Russian Revolution of 1905 as a gigantic hammer of "oppression" that strikes the head of Tsar (here, "Czar") Nicholas II. The effect, the cartoonist hopefully envisions, is to make Russia's authoritarian ruler see the stars of "liberty," "freedom," "constitution," and "parliament"; that is, to accept a constitutional monarchy

The most significant effect of the events described in the above graphic was—



a

the exchange of ideas on religion between the old and new worlds

b

a long term decline in the economies of Europe

c

catastrophic reduction of native populations in the New World

d

the introduction of tobacco products into Africa

Answers

Answer:

a

the exchange of ideas on religion between the old and new worlds

What happens when different religions come together?

Answers

Answer:

good question

Explanation:

Answer:

many things

Explanation:

sometimes they clash, especially when they don't agree with each other, or, if one tries to take over the other, but sometimes they might collab and make new religions that are based off of or similar to other ones.

The 1925 Scopes monkey trial pitted religious conservatives against

Answers

Answer:

Darwinism

Explanation:

In 1925, a teacher of Physics and Maths named John scopes taught the Theory of evolution proposed by Charles Darwin in a public school of Tennessee.

In Tennessee, the teaching of evolution was a misdemeanour or illegal according to the Butler act. The religious communities believed in the Bible that all organisms are the same from the beginning of the Universe. When he taught evolution, he was charged with the violation of the Butler act. The case was brought into the courthouse and the trial began for the case.

This trial was known as Scopes Monkey trial and the was between the religious conservatives (anti- evolutionists) and the evolutionary or supporting the Darwinism.

Thus, Darwinism is the correct answer.

Which natural resource is the most limited in Western Europe

Answers

Answer:

Europe has limited deposits of oil and natural gas, which are drilled for energy and fuel.

Explanation:

Answer:

oil and natural gas

Explanation:

Which group of Americans is most likely to vote according to historical voting trends?
A. people in their early 30s
B. middle-aged adults
C. high school graduates
D. senior citizens

Answers

Answer:

D

Explanation:

Answer:

based on a graph that I found and by the information that I already know D senior citizens.

What group of vikings settled in Russia during the 16th Century?


the saxons

the Rus

the Tatars

the Danes

Answers

Answer:

the Saxons

Explanation:

because they were the only Vikings

Answer:

The Rus

Explanation:

Kievan Rus was a viking leader who led the Rus vikings from around the 10th century to 16th century. The vikings kept the name "The Rus" in honor of the viking leader. So the group of vikings in russia during that time was "The Rus".

(Have a nice day!)

The Declaration of Independence states that_

Answers

Answer:

We hold these truths to be self-evident, that all men are created equal, that they are endowed by their Creator with certain unalienable Rights, that among these are Life, Liberty and the pursuit of Happiness.--That to secure these rights, Governments are instituted among Men,

Explanation:

You are welcome

What was the purpose of the Dawes Plan?

Answers

Answer:

The Dawes Plan was a historic economic plan to spread over many years German war reparations after World War I and to grant loans to Germany of $200 million to pay them back. It was developed to stabilize the German post-war economy by a team of experts led by the American banker Charles Dawes. It was adopted on August 16, 1924 during the so-called the London Conference and passed as binding by the Reichstag on August 30, 1924.  The Dawes Plan, as a long-term strategy of conducting economic policy towards Germany, contributed to the temporary reduction of political and economic tensions in Europe.

Marcus, a black American teenager, is stopped while driving in a wealthy area,
but Zachery, a white American teenager, is not stopped while driving in the
same area. The best way for a white person to help end this type of white
privilege is to say

Answers

Answer:

Arrest him and you need to arrest me.

Explanation:

The Declaration of Sentiments focused specifically on the rights of women who were
citizens and should have had equal rights.
married and should have had equality with their husbands.
unmarried and needed to support themselves.
unmarried and should have been required to go to school.

Answers

Answer:

answer is a

Explanation:

“It is for us the living, rather, to be dedicated here to the unfinished work which they who fought here have thus far so nobly advanced. It is rather for us to be here dedicated to the great task remaining before us—that from these honored dead we take increased devotion to that cause for which they gave the last full measure of devotion—that we here highly resolve that these dead shall not have died in vain—that this nation, under God, shall have a new birth of freedom—and that government of the people, by the people, for the people, shall not perish from the earth.”
Abraham Lincoln, Gettysburg Address, November 1863
Which of the following most directly contributed to the conflict referred to in the excerpt?

Answers

Answer:

November 1863

Explanation:

Based on the ideas of Social Darwinism, government should ______. regulate the growth of trusts support education not interfere in business.

Answers

Answer:

regulate the growth of trust

Explanation:

What beliefs about rights were important to the American colonists?

Answers

Answer:

I. Natural Rights of the Colonists as Men. Among the natural rights of the Colonists are these: First, a right to life; Secondly, to liberty; Thirdly, to property; together with the right to support and defend them in the best manner they can.

Other Questions
why human are not responsible for global warming? Which of the following cells can generate ATP through glycolysis? A. Eukaryotic Cells (Plants and Animals) B. Prokaryotic Cells (Bacteria) C. None of the above D. All of the above What is the length of EF in the right triangle below? Choose one of the three themes (social oppression, greed, or good vs. Evil) and explain something you know about it in the real world OR explain where else you have seen the theme (a book, movie, show, etc.) Please help quick What is f(2) if f(x) = 2x-5 and f(4) if f(x) = -3x + 15step by step please! Solve.Okay here is 20 letters brainy Please which one is the right answer Please help with this What is public participation? Why is itnecessary for environmental conservation AUUUAACUGUUCUGUCUAGAG1. Construct an Explanation Based only on the information provided, why could themRNA section be translated into three different sets of amino acids, instead of just oneset?2. Use Models Use the genetic code to translate the sequence into each of the threepossible sets of amino acids.3. Draw Conclusions Which of the three sets of amino acids is the most likely to beincluded in the polypeptide? Explain your reasoning. Please help me with this homework Different cities have different sales tax rates. Here are the sales tax charges on the same items in two different cities.Complete the tables. 50 points brainliest I'm watching to wait explain the difference between essential body fat and storage body fat which is true about the subject matter of an ode?a. it is usually a well-known object such as a monumentb. it varies greatly from famous people to ordinary objectsc. it is often something imaginary or mythicald. it tends to focus on an explored exotic places Find the amount of sales tax if the sales tax rate is 5% and the cost of the winter coat is $40. Hint: this question is only asking for the sales tax. I dont get- this thing .-. b.10 ftC3 ftarea of the rectangle =area of the triangle = In "House of the Scorpion", why can't they harvest El Patron's body? (plz quickly help meh due tomorrow) Ill mark you a branilyst if you answer this question Two charged objects originally felt 12N of attraction. One charge is changed from to 3C to 6C and their distance changes from 15cm apart to 45cm apart. What is the new force of attraction ?