A store manager wishes to investigate whether there is a relationship between the type of promotion offered and the number of customers who spend more than $30 on a purchase. Data will be gathered and placed into the two-way table below.

Customer Spending by Promotion Run


Customers Spending More than $30. Customers Spending $30 or Less.
$10 off $50

15% off

$5 off $25

Buy-1-Get-1 Half Off

Which statement best describes how the manager can check if there is an association between the two variables?

A. The manager must check relative frequencies by row because there are more than two different promotions.

B.The manager must check relative frequencies by column because there are more than two different promotions.

C. The manager cannot use relative frequencies to look for an association because there are more than two different promotions.

D. The manager should check both relative frequencies by row and by column to look for an association.

Answers

Answer 1

Answer:

the answer is d

Step-by-step explanation:

I took the test on edge

Answer 2

Answer:

D

Step-by-step explanation:

have a good day /night :)


Related Questions

which set of factors matches theses partial products? 3x50=150. 3x7=21

Answers

Answer:

ye

Step-by-step explanation:

hurry and answer please

Answers

It's c (48)

because if you divide all of them its 3

Nov 27, 8:06:26 PM
Find the Area of the figure below, composed of a rectangle and a semicircle. Round to
the nearest tenths place.
14
10
Answer:
Submit Answer

Answers

Answer:

The area of given figure is: 179.3

Step-by-step explanation:

The figure consists of a rectangle and a semi-circle

The length of rectangle is 14 and width is 10.

The width of rectangle is also the diameter of the semi-circle.

So,

d = 10

[tex]r = \frac{d}{2} = \frac{10}{2} = 5[/tex]

Area of Semi-Circle:

[tex]C =\frac{ \pi r^2}{2}\\= \frac{3.14 * (5)^2}{2}\\=\frac{3.14*25}{2}\\=\frac{78.5}{2}\\= 39.25[/tex]

Area of Rectangle:

[tex]R = Length * Width\\R = 10*14\\R = 140[/tex]

The total area will be the sum of area of rectangle and the area of semi-circle

So,

[tex]Total\ Area = C + R\\= 39.25 + 140\\=179.25[/tex]

Rounding off to nearest tenth

The total area is: 179.3

Four siblings have a dog walking business. The table shows the hours worked by sibling. sibling earns $25.50 per hour and the total number of hours worked is represented by 10h + 15, where h represents the number of hours Michael worked. Sibiling Hours Worked Martin 2. 5h +3 Emillo 4(h – 2) Michael Mario 31 What was the total amount the siblings earned?​

Answers

Answer:

I couldn't find out how many hours Michael worked but the total amount is $1504.50

Step-by-step explanation:

The ratio of the number of people who own a Samsung Galaxy to the number of people
who own an iPhone is 3 : 5. If 1,000 more people own an iPhone than a Samsung
Galaxy, how many people own each type of phone?

Answers

Answer:

answer and explanation below

Step-by-step explanation:

that means 2/5 is 1000 so 1/5 is 500 so 500times 3/5 is 500 times 3

so galaxy=1,500 and iphone=2,500 and 1,500/2,500 gets reduced to 3/5 so it is rigth

Ms. Strauss fills gum and trinket machines in front of grocery stores. In the trinket machine, there tattoos and stickers. If Mrs. Strauss puts 25 tattoos and 45 stickers in a machine, what is the ratio of stickers to all of the trinkets in the machine

Answers

i believe that it is 9:14

stickers:trinkets
45:70 = 9:14

could someone please help me with #7 and #8?

Answers

Answer: I'm not sure If i'm right because I did this since 8th grade.

For number 7, I think it would be (the equation form)= 6 x  +  16

For number 8, I think it would be nothing because there is no solution.

Hope this helps:)

7. Plug in 3x + 8 for y in second equation
2(3x + 8) = 6x + 16
6x + 16 = 6x + 16
It would be all solutions

8. Plug in 4x + 5 for y in second equation
12x - 3(4x + 5) = 9
12x - 12x - 15 = 9
12x cancels out
-15 = 9
There would be no solution

304,056 trying to represent the value of this number using expanded notation we give the answer but is giving us an error so we want to find out our error

Answers

Answer:

(3 * 100,000) + (0 * 10,000) + (4 * 1000) + (0 * 100) + (5 * 10) + (6 * 1)

Step-by-step explanation:

We want to represent the value of this number using expanded notation

Mathematically, that will be;

(3 * 100,000) + (0 * 10,000) + (4 * 1000) + (0 * 100) + (5 * 10) + (6 * 1)

= 300,000 + 0 + 4000 + 0 + 50 + 6

= 304,057

(I'LL GIVE BRAINLIEST AND EXTRA POINTS FOR WHO EVER HELPS ME!! :) )


Solve five and six eighths plus four and four fifths.


A) nine and twenty two fortieths

B) nine and three twenty eighths

C) ten and twenty two fortieths

D) ten and eleven thirteenths


( Here is an image if needed):

Answers

Answer:

C

Step-by-step explanation

Answer:

C.)

Step-by-step explanation:

First, let's make it so that 6/8 and 4/5 have the same denominator.

Find the LCM: 40

8 ÷ 40 = 5

5 ÷ 40 = 8

Now that we have this info, let's convert the numerator to match the denominator.

4/5:

4 × 8 = 32

So... 4/5 = 32/40

6/8:

6 × 5 = 30

So... 6/8 = 30/40

Now let's add:

30/40 + 32/40

30 + 32 = 62

Therefore: 62/40

Now let's add those whole numbers: 5 + 4 = 9

Our answer: 9 62/40

Let's simplify: 10 22/40

Therefore, C is the correct answer.

4x - 3y = 1
-8x + 6y = -2

Answers

Answer:

x = infinite amount of solutions

General Formulas and Concepts:

Pre-Algebra

Order of Operations: BPEMDASEquality Properties

Algebra I

Solving systems of equations using substitution/eliminationSolving systems of equations by graphing

Step-by-step explanation:

Step 1: Define systems

4x - 3y = 1

-8x + 6y = -2

Step 2: Rewrite systems

-8x + 6y = -2

Add 8x to both sides:                   6y = 8x - 2Divide 6 on both sides:                y = 4/3x - 1/3

Step 3: Redefine systems

4x - 3y = 1

y = 4/3x - 1/3

Step 4: Solve for x

Substitution

Substitute in y:                         4x - 3(4/3x - 1/3) = 1Distribute -3:                            4x - 4x + 1 = 1Combine like terms:                1 = 1

Here we see that 1 does indeed equal 1.

∴ x = all real numbers/infinite amount of solutions

Step 5: Graph

Check the systems.

We see that the 2 equations are the same line.

MULTI-QUESTION
What is the rise from point A to point D?
What is the run from point A to point D?
Write the fraction of rise over run from A to D (reduce if possible)
Find the rise from Point C to point B.
Find the run from Point C to Point B.
Write the fraction of rise over run from C to B.
Does the line have a positive or negative slope?
What is the slope of line AD?

Answers

Answer:

See below

Step-by-step explanation:

What is the rise from point A to point D?

8 units

What is the run from point A to point D?

4 units

Write the fraction of rise over run from A to D (reduce if possible)

8/4= 2

Find the rise from Point C to point B.

2 units

Find the run from Point C to Point B.

1 unit

Write the fraction of rise over run from C to B.

2/1=2

Does the line have a positive or negative slope?

Positive

What is the slope of line AD?

Slope = rise/run = 2

9.5 +5² - 2² (-3)rasied to the 2nd power

Answers

-1.5 dndekekckcl fkckkcekekxk k

Vanessa made some purchases at Kroger. She bought two containers of blueberries for $3.25 each, three containers of strawberries for $2.50 each and one container of raspberries for $5.94. If sales tax is 3 ½%, how much will Vanessa pay for her items? Round to the nearest hundredth. Include your units

Answers

Add up all her items first
$3.25 + $2.50 + $5.94 = $11.69
Sale tax = 0.035
11.69 * 0.035 = 0.41
11.69 - 0.41 = $11.28

Evaluate the surface integral SSs (x + y + z)ds, s is the parallelogram with parametric equations x = u + v, y = u - v, z = 1 + 2u +v, 0 <= u <= 2, 0 <= v <=1

Answers

The surface element is

dS = || ∂r/∂u  x  ∂r/dv || du dv

where

r (u, v) = x (u, v) i + y (u, v) j + z (u, v) k

r (u, v) = (u + v) i + (u - v) j + (1 + 2u + v) k

is the vector parameterization for the surface S.

The normal vector to the surface is

r/∂u  x  ∂r/dv

… = (i + j + 2 k)  x  (i - j + k)

… = 3 i + j - 2 k

and has norm

|| ∂r/∂u  x  ∂r/dv || = √(3² + 1² + (-2)²) = √(14)

Now compute the integral:

∫∫ (x + y + z) dS = √(14) ∫₀¹ ∫₀² ((u + v) + (u - v) + (1 + 2u + v)) du dv

… = √(14) ∫₀¹ ∫₀² (3u + v + 1) du dv

… = √(14) ∫₀¹ (3/2 u² + uv + u) |₀² dv

… = √(14) ∫₀¹ (8 + 2v) dv

… = √(14) (8v + 2v²) |₀¹

… = 10 √(14)

Calculate the following speed.

Distance = 800 m, time = 50 sec

Answers

Answer:

16m per second

Step-by-step explanation:

Answer:

16 m/sec

Step-by-step explanation:

Formula

S = d/t

s = 800/50

s = 16 m/sec

5 points
12. A man drove 350 miles in 4.5 hours. If the posted speed limit was 65
mph (miles per hour) the entire way, approximately how many miles per
hour over the speed limit was he going?*
O 1 mph
O 5 mph
O 13 mph
O 78 mph

Answers

Answer: 13

Step-by-step explanation:

Miranda invited 117 guests to a charity event. Miranda is renting tables that seat 9 guests at each table. If each table costs ​$4 to​ rent, how much will Miranda spend to rent the​ tables?

Answers

Answer: $468.00

Step-by-step explanation:

f(x)=6x+5 and g(x)=2x-4

Answers

Step-by-step explanation:

1.)you find

f(g(x))

2)set up the composition function and evaluate

f(2x+4) = -12x - 19

5 = 5/8x + 1/2x - 4 with work please :) its due in a couple minutes ​

Answers

Answer:

5/8x+1/2x-4=5

or, 5(2x-4)+8x= 5

or, 10x- 20+8x=5

or, 10x-8x= 20+5

or, 2x= 25

or,x= 25/2

:.x= 25/2

Step-by-step explanation:

first we have to make denominator then we can criss cross multiply. we can make in same point .if there is plus we can subtract and if there is front minus if we take it back it must be plus. then we can put same point then we can divide

Last year, the cost of a family-sized dinner at a picnic was $8.50. This year, the cost is $11.56. What is the percent of increase of the price? ( I need a step-by-step explanation not just the answer) ill give brainliest

Answers

to find the percentage increase, take the price increase divided by the original price :
price increase = $11.56 - $8.50 = $3.06

percentage increase = $3.06/$11.56 x 100%
= 26.47% (or 26.5%)

hope the explanation was able to help!!

When twice a number is subtracted from 34, the result is 16. Find the number.
O A. 8
OB. 16
C. 12
OD. 9

Answers

Answer:

9

Step-by-step explanation:

34 - 16 = 18

18 ÷ 2 = 9

you're welcome! I'm a 6th grader btw!

Answer:

9

Step-by-step explanation:

34-2x=16

-2x=16-34

-2x=-18

2x=18

X=18/2

X=9

So the answer is 9.

What is Point-Slope Form? What is Slope Intercept Form? What is the Slope Formula?
i included pictures please help it closes tonight

Answers

Answer:

Point slope form: y-y₁=m(x-x₁)

Slope-Intercept form is y=mx+b....

Slope formula is m=y-y/ (over) x-x

Step-by-step explanation:

Consider the equation 5x + 7 = 2x + 28. Your tasks to explain the steps you would take, in
order, to solve the equation for x. Imagine that you are writing this for someone who is learning
about this process for the first time. You would be as specific as possible and write in complete
sentences.

Answers

Answer:

x=7

Step-by-step explanation:

Step 1: Put the variables and constants on the same side and change their signs so it'll look like this 5x-2x = 28 - 7, you always move the smaller number to either the left or right depending on its position in the problem.

Step 2: solve each side normally like this, 3x = 21

Step 3: to get x by itself divide 3 on both sides and you should get x=7

Here's a run through of the steps

5x+7=2x+28

   -7       -7(subtract 7 from both sides

5x=2x+28-7

-2x   -2x(subtract 2x from both sides)

5x-2x=28-7

3x=21

3x/3 = 21/3 (divide 3 from both sides)

x=7

Can anyone help me ??

Answers

Answer:

16

Step-by-step explanation:

2 times 2 = 4 times 4= 16 times 1= 16

Answer:

16

Step-by-step explanation:

What is the solution to the system: ax+y=18 and 4ax-y=12? Use elimination. Put the answer as an ordered pair. Show work on the next question. You have 3 unknowns and only 2 equations so you can have the variable "a" in your solution

Answers

Answer:

Ax=6

Y=12

Therefore a=6, x=1, y=12

Answer:

{([tex]\frac{6}{a}[/tex],12)}

Step-by-step explanation:

[tex]\left \{ {{ax+y=18} \atop {4ax-y=12}} \right.[/tex]

[tex]5ax = 30[/tex]

[tex]x = \frac{6}{a}[/tex]

[tex]a(\frac{6}{a}) + y = 18[/tex]

6 + y =18→y=12

[tex]4a(\frac{6}{a}) - 12 = 12[/tex]

6 - 12 = 12 → 12 = 12 true  x=[tex]\frac{6}{a}[/tex]  y=12

Sheila picks for 1 1/4 pounds of blueberries for $10 how many pounds can she pick for $1​

Answers

Answer:

0.125 pounds of blueberries

Step-by-step explanation:

Trust me

Answer:

1/8

Step-by-step explanation:

1 1/4=1.25

1.25/10=0.125

0.125 in the simplest fraction form is 1/8

hope this helps :3

if it did pls mark brainliest

Kaelyn is reading a book. The books thickness is 25 millimeters. How many of these books would fit on a shelf that is 1 meter long?

Answers

40

1000/25=40

You’re welcome

The number of books that can be fit on a shelf is 1 meter long and will be 40.

What is Algebra?

Algebra is the study of mathematical symbols, and the rule is the manipulation of those symbols.

Kaelyn is reading a book.

The book's thickness is 25 millimeters.

Then the number of the books that can be fit on a shelf is 1 meter long will be

Let x be the number of the books.

The thickness of the book in meters will be 0.025 m.

Then we have

0.025x = 1

         x = 1 / 0.025

         x = 40

More about the Algebra link is given below.

https://brainly.com/question/953809

#SPJ2

Which expression is the additive inverse of 25?

Answers

Answer:it’s actually very simple it’s A.

Step-by-step explanation: anything that is below one is negative that’s how I got my answer.

Answer:the answer is A

Step-by-step explanation:i did the test

14. The first tree on the left is 8cm tall and is 30cm from the vanishing point. If the third tree is 20em from the

vanishing point, how tall is it?

d.

160 cm

8 cm

C.

b. 0.1875 cm

a.

5.3 cm

Answers

Answer:

5.3cm

Step-by-step explanation:

Step one:

given data

First tree

the tree is 8cm tall

and 30cm from the vanishing point

Third  tree

let the tree be x cm tall

and 20cm from the vanishing point

Step two:

if 8cm tree will be 30cm at the vanishing point

then x cm tree will be 20cm at the vanishing point

cross multiply we have

x= (20*8)/30

x=160/30

x=5.3cm

The third tree is 5.3cm tall

Which integer represents a temperature of 9 degrees below freezing?

Answers

Answer:

Step-by-step explanation:

Freezing is 32 degrees F.

32-9= 23 degrees F.

Other Questions
Anchara drops a penny from a height of 60 feet above the ground. The equation h=-16t^2 + 60 models the penbys height h i feet as a function of time t in seconds whatvare the solutions P3- is a(n) ______________________, so it ________________ valence electrons. Group of answ er choices anion, gained cation, gained cation, lost anion, lost The following DNA is being replicated and the origin of replication is in the middle of the sequence and marked with three stars ***. 5'ATCGGGCTACCCATGAAATGCTAGCATT***TAAGATCTTAAGCTAGCTAGTTCGATCTGA3'What is the sequence of the primer for the LEADING strand? Your answer should be 8 nucleotides long, written from 5' to 3' and only include the nucleic acid sequence (ex: ACTACTAC).note: there are two answers for this question A farmer's market is selling peaches for $2.00 a pound. If you buy 2 pounds, you save 10% on each pound. How much does it cost to get 2 pounds of peaches? 1. What right do education encompasses both entitlements and freedom?A. Right to free and compulsory primary educationB. Right the quality education in private schoolC. Right to choose yourteachersD. All of the above2. Which of the following is an example of non-formal education?A. Primary schoolingB. Senior high schoolC. Adult night classesD. Doctorate program El libro. _____ Libros. Approximately how many people are likely trafficked into the United States each year?5,5008,5008,50011,50011,500-14,500O 14,50017,500 She dove 75 feet under the sea To be eligible for Bright Futures, you must submit a statement explaining how all money will be repaid submit a plan of action for all courses throughout college take at least three remedial credits in the first semester take at least six non-remedial credits per semesterplease only answer if you know what your talking aboutand if your right i will give brainiest. What was the biggest drawback of Chinese block printing? In a perfectly insulated container of negligible mass, 4.00 102 kg of steam at 100C and atmospheric pressure is added to 0.200 kg of water at 50.0C. A) If no heat is lost to the surroundings, what is the final temperature of the system? B) At the final temperature, how many kilograms are there of steam and how many of liquid water? What is the importance of the Battle of Khanua and Chaunsa? VocabularyMake a sentence using these two wordsdedicated, obstaclecollaborate, techniques 3) Complete the sentences. Use the Past Simple or the Present Perfect Simple form of the verbs in brackets1 Marry_____(win) the lottery last year.2 I _____(not see) anyone yet.(come/just) home.4. They____(buy) the car two years ago5. William still____(not buy) the present for his sister 4 Complete the sentences. Use the Present Perfect Simple or the Present Perfect Continuous form of the verbs inbracts1. The baby's face is really dirty. What____(he/eat)?2. Like____(never/be) abroad3. Eva is exhausted these days. She______(work) too hard recently.4.______(you/finish) your homework yet?5. I_____(clean) all morning I'm really tired! 6x = 10y - 10x + y + 7 = 0What is x and y? Kiran and Clare live 28 miles away from each other along a rail trail Kiran walks at a speed of 3 miles per hour while Clare walks 4 miles per hour how long will it take the two friends to meet Choose the correct conjugation of the verb DAR in the following sentence:Ustedes __________ comida por la noche.Group of answer choicesdamosdoydasdan Which of the following statements is true about covalent bonds?Valence Electrons are shared in order to achieve the bondO Covalent bonds form when the nuclei of atoms attract each otherO Covalent Bonds all have the same bond length no matter what atoms are in thebondTransferring of electrons from one atom to another creates the bond the first person with the correct answer will get the brainiest.Read the excerpt below by Walt Whitman.(Other lands have their vitality in a few, a class, but we have it in the bulk of our people.)Which statement best summarizes the excerpt?The wealthy upper class in other countries gives each nation its vitality.The powerful upper class in the United States gives the nation its vitality.The common people in other countries give each nation its vitality.The common people in the United States give the nation its vitality. There are 24 hours in 1 day. If you sleep 30% percent of the day how many hours do you sleep