According to the Institute of Management Accountants (IMA), the final step in resolving an ethical dilemma is to:

Answers

Answer 1

Answer: A. consult your own attorney as to legal obligations and rights concerning the ethical conflict.

Explanation:

After considering the relevant implications of an ethical dilemma, the final step is to reach out to your own lawyer to find out your legal rights as well as obligations concerning the courses of action that are presenting the dilemma.

The logic is that your own attorney should have your best interests at heart and so will tell you what each action could do to you which will then help you decide which course of action to take.


Related Questions

Which stage of an industry's growth cycle offers the greatest opportunity for an investor who is seeking capital gains?

a. initial development
b. mature growth
c. stability or decline
d. rapid expansion

Answers

Answer:

d. rapid expansion

Explanation:

The main objective of an investor is to invest his capital in an industry that generates profits. Therefore, analyzing the above question, it is correct to say that an organization that is expanding its business quickly, is achieving success in the market in which it operates, so this alternative is ideal for an investor seeking capital gains.

Initial development would be an alternative that does not have a real return for the investor, mature growth is also not the most profitable option, and the stability or decline option does not present a profitable and reliable alternative for an investor.

On January 1, 2010, North Co. sold equipment and accepted in exchange a $600,000 zero-interest-bearing note due on January 1, 2013. The effective rate of interest for a note of this type at 1/1/10 was 10%. Assume the present value of $1 at 10% for three periods is 0.75. What amount of interest revenue should be included in North's 2011 income statement?

Answers

Answer:

$49,500

Explanation:

Calculation for what amount of interest revenue should be included in North's 2011 income statement

First step is to find Zero-interest-bearing note due balance

Zero-interest-bearing note due balance

=$600,000 *0.75*10%

Zero-interest-bearing note due balance= $45,000

Second Step will be to calculate the interest revenue

Interest revenue=($450,000 + $45,000) *10%

Interest revenue= $495,000*10%

Interest revenue=49,500

Therefore what the amount of interest revenue should be included in North's 2011 income statement is $49,500

The State of Adaven issued $50 million of perpetual bonds in 1990. The bonds were issued in $100 denominations with an annual coupon interest rate of 5%. Determine the rate of return or current yield on these bonds if they are purchased at the current price of $40.a. 12.5%.b. 8.0%.c. 5.0%.d. 1.25%.

Answers

Answer: 12.5%

Explanation:

From the question, we are informed that the State of Adaven issued $50 million of perpetual bonds in 1990 and that the bonds were issued in $100 denominations with an annual coupon interest rate of 5%.

The rate of return or current yield on these bonds if they are purchased at the current price of $40 will be calculated as:

= (5% × $100)/$40

= $5/$40

= 0.125 or 12.5%

UBL Bank currently has PKR 4600 million in transaction deposits on its balance sheet. The State Bank of Pakistan has currently set the reserve requirement at 10 percent of transaction deposits. If the State bank decreases the reserve requirement to 8 percent, reflect the result of this transaction on the balance sheet of UBL and effect of this change on its balance sheet

Answers

Answer:

Total Assets = 4600    ,Total Liabilities = 4,600

Explanation:

Given:

Deposits = 4,600 million

Reserve requirement = 10% of deposits

Computation:

Reserve requirement = 10% x 4,600 million

Reserve requirement = 460 million

Total Assets = Reserves + Outstanding Loan

Outstanding Loan  = Deposits - Reserve requirement

Outstanding Loan  = 4,600 million - 460 million

Outstanding Loan  = 4,140 million

Balance sheet:

Assets:                                  Liabilities:

Reserves 460               Deposits         4,600

Loans         4140

Total Assets 4600            Total Liabilities 4,600

Reserve requirement = 8%

Reserves requirement = 8% x 4,600

requirement = 368 million

Outstanding  Loans = 4,600 - 368

Outstanding = 4,232  million

New Balance sheet:

Assets:                                  Liabilities:

Reserves 368               Deposits         4,600

Loans         4,232  

Total Assets 4600            Total Liabilities 4,600

Organizations must use software tools to process data into meaningful information to make _____ useful.

Answers

Answer:

data warehouses

Explanation:

In the science of computing, we can also call a data warehouse, to be an enterprise data warehouse, this is a system that is used for reporting and also analysing data, a data warehouse is known to be a very central part of business intelligence.

Organizations must use software tools to process data into meaningful information to make data warehouses useful.

Shane is a newly hired inventory manager at a manufacturing firm. What can he do to avoid shortages or excess quantity of inventory?

Answers

Answer:

take inventory on how much product he has and how much he needs

Explanation:

Answer:

Honestly not sure but I personally put "C. plan appropriate order cycles for the inventory"

Explanation:

Plato

Jones Manufacturing sells a part to Lear Corporation.Lear puts this part into a radio,which Lear then sells to Ford.From Ford's point of view,Jones Manufacturing is a(n)__________ supplier.A) Echelon 1B) Echelon 2C) Tier 1D) Tier 2

Answers

Answer:

d)Tier 2

Explanation:

from the question we are informed about jones Manufacturing sells a part to Lear Corporation.Lear puts this part into a radio,which Lear then sells to Ford.From Ford's point of view, in this case Jones Manufacturing is tier 2. Tier 2 capital can be regarded as second layer of capital which serve as a required reserves of a bankIt contains revaluation reserves as well as hybrid capital instruments

Bolt Corp. acquires equipment valued at $81,630 by signing a 3-year noninterest-bearing note payable for $100,000. Calculate the implicit interest rate on the note.

Answers

Answer:

7%

Explanation:

Calculation for the implicit interest rate on the note

First step is to calculate the PV factor

PV factor=$81,630/100,000

PV factor = 0.81630

Last Step is to find the implicit interest rate by using the PV table for 3 years to find the factor that matches the PV factor of 0.81630

Hence the factor that matches the PV factor of 0.81630 can be found or see in the 7% column which means that the implicit interest rate will be 7%

Therefore the implicit interest rate on the note will be 7%

identify items that can be included under cash,articulate the risks and controls typically associated with these accounts and summarize an audit approach for testing these accounts​

Answers

Answer:

Items of Cash : Cash and Till float

Risks : Fraud and Theft

Controls : Segregation of duties over the receipt and recording of money and Every cashier should only be responsible for his own funds.

Test of Controls : Do a surprise cash count and Enquire about and observe the controls over cash by management

Explanation:

Bank and cash transactions occur on a daily basis in all businesses. Although the cash and bank balances may not individually be significant, annually the volume of cash and payment transactions and bank deposits can be significant to the entity.

Items of Cash

Cash balances comprise the following:

Cash Petty cash Till float Unbanked receipts

Risks

Cash is highly susceptible to fraud and theft by employees, often in collusion with third parties.

To mitigate this risk related to cash balances, management will usually implement strict control policies and procedures for cash handling and recording.

Controls in the bank and cash cycle can be divided into 2 categories:

Basic controls Controls over cash

Basic Controls

Segregation of duties over the receipt and recording of money. Different forms of cash (sales, petty cash, cash loans) should be kept separately and recorded separately.Proper stationery control. Receipts, cash sales slips/invoices must be numerically recordedSafeguarding of money. Cash must be locked in a Volt and deposited as soon as possible. You would also need control over the key to the Volt.

Control over Cash

Cashier must balance cash on a daily basis and must compare it with the source documents (receipt, cash invoices, cash register totals) and record it on a cash receipt summary. The Cash Receipt Summary must be Signed by the Cashier, Independently reviewed by the Senior Official.Every cashier should only be responsible for his own funds. Usually during lunch. Cash registers must be locked away.Every cashier should be responsible for his own float. They should lock in Cash Drawer.Supervision over cashiers. Through the use of Cameras.Cash must be banked as soon as possible.

Audit approach for testing these accounts

Enquire about and observe the controls over cash by management.Do a surprise cash count (also attend on a surprise basis the daily balancing of cash). In the presence of a Cashier who signs back of the receipt, agree the cash with the supporting documentation (receipts, cash invoices, cash register total) and follow the float through to the balance in the ledger.At a later stage follow the cash counted through to deposit slip, and agree it with the cash counted, ensure they are banked timeously and follow the total of the deposit slip through to the cash book and bank statement.

Suppose that the Office of Management and Budget provides the accompanying estimates of federal budget receipts, federal budget? spending, and GDP, all expressed in billions of dollars. Calculate the implied estimates of the federal budget deficit as a percentage of GDP for each year. (Enter each response as a percentage rounded to one decimal place. Do not include a plus or minus sign.)Year Federal Budget Federal Budget GDP (0% growth) Deficit as a Receipts (5% growth) Spending (2% growth) % of GDP 2015 $2,329.8 $2,682.6 $14,573.2 %2016 2,446.3 2,736.3 14,573.2 %2017 2,568.6 2,791.0 14,573.2 %2018 2,697.0 2,846.8 14,573.2 %

Answers

Answer:

For each year, calculate the budget deficit then make it a percentage of GDP.

Budget Surplus (deficit) = Government receipts - Government Expense

2015

Deficit as percentage of GDP = (2,329.8 - 2,682.6) / 14,573.20

= 2.4%

2016

= (2,446.3 - 2,736.3) / 14,573.2

= 2.0%

2017

= (2,568.6 - 2,791.0) / 14,573.2

= 1.5%

2018

= (2,697.0 - 2,846.8) / 14,753.2

= 1.0%

Answers rounded to one decimal place. and no signs, plus or minus, included, as per the question specification.

At December 31, 2020, Burr Corporation owes $500,000 on a note payable due February 15, 2021.(a) If Burr had restructured the note on December 15, 2020, such that Burr has the contractual right to defer payment of $250,000 of the note until February 15, 2022, how much of the $500,000 should be reported as a current liability at December 31, 2020

Answers

Answer:

$250,000

Explanation:

First and foremost, initially the whole amount payable( $500,000) was to be paid in one month and 15 days counting from December 31, 2020, hence, since the amount is payable within a  year, it should have been classified as the current liability.

However, the refinancing meant that  $250,000 would be deferred to 2022 while the balance of $250,000 ($500,000-$250,000) is still payable on the agreed date (February 15, 2021).

As a result, $250,000  would be reported as a current liability while the balance  of $250,000 is shown as non-current(long-term) liability.

Of the $500,000 Note Payable, $250,000 should be reported as a current liability by Burr Corporation, while the remaining $250,000 should be reported as a long-term liability.

Data and Calculations:

Note Payable on December 31, 2020 =$500,000

Maturity date = February 15, 2021

Restructuring date = December 15, 2020

New Maturity date after restructuring = February 15, 2022

Current liability at December 31, 2020 = $250,000 ($500,000 - $250,000)

Long-term liability = $250,000 ($500,000 - $250,000)

Thus, in the balance sheet as of December 31, 2020, Burr Corporation can report $250,000 as a current liability instead of $500,000. The remaining $250,000 is reported as a long-term liability.

Learn more: https://brainly.com/question/18359733

the nash corp is considering four investments. Which provides the highest after-tax return for Nash corp. if it is in the

Answers

Answer:

ejrjfjfn

Explanation:

sudjfjejrjfngnv vjvkvkvk

Lon's GPS, Inc., orders 500 Class A widgets to be installed in GPS units it is manufacturing. When delivery is made on Monday, the widgets delivered are Class B. Lon's signs a receipt accepting the nonconforming shipment. The next day, Lon's installs some of the Class B widgets and finds that they perform with half the accuracy of the Class A widgets. What, if any, options does Lon's have?

Answers

Answer and Explanation:

In the most cases when a shipment of goods are accepted i.e. not confirmed so here the buyer could adjust the prices also he has the right to reject the goods.

In the given case, UCC provides that the goods that are non confirmed is accepted and these goods want to impair so the buyer has the right to revoke the acceptance this can be done with the reasonable time

Blue Spruce Corp. incurs the following expenditures in purchasing a truck:

Cash price $53,000
Accident insurance $3,800
Sales taxes $3,400
Motor vehicle license $100
Painting and lettering $400.

What is the cost of the truck?

Answers

Answer:

$56,800

Explanation:

The cost of the truck is calculated as;

= Cash price + Sales tax + Painting and lettering

Given that;

Cash price = $53,000

Sales tax = $3,400

Painting and lettering = $400

= $53,000 + $3,400 + $400

= $56,800

Therefore, cost of the truck is $56,800.

* Note

The expenditures for accident insurance and motor vehicle license will not be added to the cost of the truck.

TIME REMAINING
29:35
What gives the US government the power to collect taxes?

the Constitution
laws passed by Congress
an executive order
common law

Answers

Answer:

The Constitution

Explanation:

In the United States, Article I, Section 8 of the Constitution gives Congress the power to "lay and collect taxes, duties, imposts and excises, to pay the debts and provide for the common defense and general welfare of the United States. This is also referred to as the "Taxing and Spending Clause."

John's Mattresses is now selling its products in Spain. It has priced its line of mattresses very low in the hopes that it will drive away weaker competitors. This is an example of:________

Answers

Answer: predatory pricing.

Explanation:

John's Mattresses is now selling its products in Spain. It has priced its line of mattresses very low in the hopes that it will drive away weaker competitors. This is an example of predatory pricing.

Predatory pricing is when a company intentionally reduces its price in order to reduce competition. It should be noted that this can lead to monopoly and it violated the antitrust law.

An investor can invest money with a particular bank and earn a stated interest rate of 8.80%; however, interest will be compounded quarterly. What are the nominal (or stated), periodic, and effective interest rates for this investment opportunity? Interest Rates Nominal rate 8.80% Periodic rate 6.12% Effective annual rate 9.00%

Answers

Answer:

nominal interest rate = 8.8%

periodic interest rate = 2.2%

the effective interest rate = 9.09%

Explanation:

nominal interest rate is the rate given to the investor = 8.8%

periodic interest rate = nominal interest rate / total number of compounding periods per year = 8.8% / 4 = 2.2%

the effective interest rate = (1 + periodic interest rate)ⁿ - 1 = (1 + 8.8%/4)⁴ - 1 = (1 + 8.8%/4)⁴ - 1 = (1 + 2.2%)⁴ - 1 = 1.0909 - 1 = 0.0909 = 9.09%

Hello I need help with this question

Classify each statement according to whether it will increase the equilibrium level of human capital investments or decrease the equilibrium level of human capital investments.

Answers

Answer:

Congress votes to double the amount of federally subsidized student loans - this will increase the equilibrium level of human capital investments because higher education is one of the most effective ways that people can use to increase their human capital.

There is a decrease in student learning capacities - decrease the equilibrium level of human capital investments because a lower learning capacity will prevent students from reaching their full potential.

Suburban families see a decrease in wealth due to a particularly poor performing sotck market - decrease because suburban families will have less income and wealth to spend, including expenditures in education and training.

The president signs into a law a bill that will reduce discrimination in the labor market - increase because workers that were previously kept from finding employment due to discrimination will now be able to obtain jobs and acquire working experience, this increases their human capital.

The natural talents and abilities of graduating high school students rise - increase because high school graduates have become more naturally skilled and this will help them through college and in their future jobs.

Fiat money:________.a) has no intrinsic value. b) is backed by gold. c) is a medium of exchange but not a unit of account. d) is any close substitute for curren

Answers

Answer: a) has no intrinsic value

Explanation:

Fiat currency is money that is used in a country and is regulated by the central bank of that country. Fiat money has no commodity backing it such as gold or silver and has no intrinsic value of its own.

It is instead backed by the full faith and credit of the government of the country that produces it. For instance, the US dollar is backed by the full faith and credit of the US government.

Hayden Company currently sells widgets for $160 per unit. The variable cost is $60 per unit and total fixed costs equal $240,000 per year. Sales are currently 40,000 units annually, and the income tax rate is 40 percent. Required: a. Calculate the contribution margin per unit. b. Calculate break-even in units. c. Calculate break-even in sales dollars d. Calculate the current after-tax net income. e. The company is considering a 10% drop in the selling price that it believes will raise units sold by 15%. Assuming all costs stay the same, what is the impact on income if this change is made? f. How many units need to be sold to earn a pre-tax operating income of $100,000?

Answers

Answer:

a. $100

b. 2,400 units

c. $380,952

d. $2,256,000

e. 15.90 %

f. 3,400 units

Explanation:

Contribution margin per unit

Contribution margin per unit = Sales per unit  less Variable Cost per unit

Therefore,

Contribution margin per unit = $160 - $60

                                                = $100

Break-even in units

The Breakeven units is the level of activity where a firm makes neither a profit nor a loss.

Break-even in units = Fixed Cost ÷ Contribution margin per unit

Therefore,

Break-even in units = $240,000 ÷ $100

                                 = 2,400 units

Break-even in sales dollars

Break-even in sales dollars = Fixed Cost ÷ Contribution margin ratio

Where,

Contribution margin ratio = Contribution margin ÷ Sales

                                           = $100 ÷ $160

                                           = 0.63

Therefore,

Break-even in sales dollars = $240,000 ÷ 0.63

                                              = $380,952

After-tax net income

Contribution ( $100 × 40,000 )    $4,000,000

Less Fixed Cost                             ($240,000)

Next Income Before Tax              $3,760,000

Less Income tax at 40 %             ($1,504,000)

Net Income After Tax                   $2,256,000

Effect of the Change on Income

First, calculate the Degree of Operating Leverage (DOL).

The DOL shows the times Net Income Before Interest and Tax will change as a result of a change in sales contribution.

Degree of Operating Leverage (DOL) = Contribution ÷ Net Income

Therefore,

Degree of Operating Leverage (DOL) = $4,000,000 ÷ $3,760,000

                                                               = 1.06

Effect on Income using the DOL = 1.06 × 15% = 15.90 %

Therefore Net Income would also increase by 15.90 %.

Units to be sold to earn an income of $100,000

Units to Earn a Target Profit = (Fixed Costs + Target Profit) ÷ Contribution margin per unit

Therefore,

Units to be sold to earn an income of $100,000 = ($100,000 + $240,000) ÷ $100

                                                                                = 3,400 units

Because nonprofit organizations do not have a conventional __________, managers may struggle with the question of what constitutes results and effectiveness.

Answers

Answer:

bottom line

Explanation:

In simple words, a bottom line refers to the net income that appears on the bottom of the income statement of the year. Since the non profit organisation works for the betterment of the society they do no possess it.

The lack of bottom line results in difficulties for the managers to handle the operations and to take decisions regarding operations that results in operational effectiveness as there is no parameter to judge the current process.

Monopolistic competition is defined by product differentiation .explain

Answers

Explanation:

Product differentiation is the means used by a firm in a monopolistic competitive market with many firms selling similar products to differentiate its product from that of other firms

Answer:

In Monopolistic Competition, a buyer can get a specific type of product only from one producer. In other words, there is product differentiation. The firms have to incur selling expenses since there is product differentiation. There is a large number of sellers with inter-dependent demand and supply conditions

Explanation:

Paul Corporation reported net income of $260,000 during the current calendar year. The company had 10,000 common shares outstanding on January 1 and sold an additional 6,000 shares on July 1. What is the company’s basic EPS?

Answers

Answer:

the company’s basic EPS is $37.14

Explanation:

Basic Earnings per share = Earnings attributable to holders of common stock ÷ Weighted Average Number of Common Stocks

Step 1 : Calculation of Earnings attributable to holders of common stock

This is given. It is the Net Income during the current year of $260,000

Step 2 : Calculation of Weighted Average Number of Common Stocks

Outstanding Stocks at the beginning of the year                 10,000

Less Sold Stocks - On Weight Basis (6/12 × 6,000)               3,000

Weighted Average Number of Common Stocks                    7,000

Therefore,

Basic Earnings per share = $260,000 ÷ 7,000

                                           = $37.14

Cash outflows for McKinney Publishing in 2020 included:________. $347,000 in salaries to authors. $180,000 in fees to contracted editors. $83,000 to obtain copyrights for 15 new books. $1.3 million to purchase a new printing warehouse. $560,000 to upgrade current printing equipment. How much of these cash outflows will McKinney Enterprises expense?

Answers

Answer: $527,000

Explanation:

Salaries to authors = $347,000

Fees to contracted editors = $180,000

Copyrights obtained = $83,000

Purchase of a new printing warehouse = 1.3 million

Upgrade of current printing equipment = $560,000

McKinney Enterprises expense will be:

= Salaries to authors + Fees to contracted editors

= $347,000 + $180,000

= $527,000

If a central bank wishes to reduce inflation, it should announce its intentions and follow through with them, thereby using _________ monetary policy.
A. visible
B. integral
C. credible
D. authoritative

Answers

Answer:

C. credible

Explanation:

A credible monetary policy is the policy where the problem of inconsistency of time can be avoided also the biasness of the inflation also it keeps the inflation under a control.

Therefore in the case when the central bank wants to decrease the inflation so they are using the credible monetary policy

Hence, the correct option is C.

Suppose that a country's economy is operating at an unemployment rate 6% higher than its natural rate of unemployment. Then a(n) __________ exists and government should _________.a. inflationary gap; increase spendingb. inflationary gap; decrease spendingc. recessionary gap; increase spendingd. recessionary gap; decrease spending

Answers

Answer:

c. recessionary gap; increase spending

Explanation:

When the country's economy is operating at an unemployment rate that is higher than its natural rate of unemployment, that means a lower level of consumer demand due to the fact that more number of people don't have jobs. Which in turn implies lower production level and thus lower GDP and thus causes a recessionary gap. In order to fill this recessionary gap the government should increase spending so as to boost money into the economy which will then boost consumer demand and thereby production level will increase and in turn will fill the gap.

Susmel Inc. is considering a project that has the following cash flow data. What is the project's payback

Answers

Answer: 2.5 years

Explanation:

The payback period of a project as the term implies, is the amount of time it takes for a project's cashflows to pay off its original outlay.

The formula is;

= Year before payback + Amount remaining/ Cashflow in year of Payback

Year 1 + 2 = 150 + 200 = $350

Amount remaining = 500 - 350 = $150

Payback period = 2 + 150/300

= 2.5 years

Joe's Mart policy is to have 20% of the next month's sales on hand at the end of the current month. Projected sales for August, September, and October are 36,000 units, 31,000 units, and 41,000 units, respectively. How many units must be purchased in September?A. 16,000.B. 17,000.C. 22,000.D. 26,000.E. 28,000.

Answers

Answer:

the number of units purchased in September is 33,000 units

Explanation:

The computation of the number of units purchased in September is shown below:

= September sales + desired ending inventory - beginning inventory

= 31,000 + 41,000 × 20% - 31,000 × 20%

= 31,000 + 8,200 - 6,200

= 33,000 units

This is the answer but the same is not provided in the given options

hence, the number of units purchased in September is 33,000 units

We simply applied the above formula so that the correct value could come

And, the same is to be considered

Waterway Industries purchased machinery for $905000 on January 1, 2017. Straight-line depreciation has been recorded based on a $52000 salvage value and a 5-year useful life. The machinery was sold on May 1, 2021 at a gain of $13000. How much cash did Waterway receive from the sale of the machinery?

Answers

Answer:

$ 178,733  

Explanation:

From January 2017 when the machinery was acquired till May 1 2021  when it disposed of, depreciation would have been charged for full years 2017,2018,2019 and 2020 while 2021 depreciation would only be for 4 months.

Annual depreciation=cost-salvage value/ useful life

annual depreciation=($905000-$52000)/5=$170,600  

depreciation for 4 years=$170,600*4=$682,400

depreciation for 4 months=$170,600*4/12=$56,867  

accumulated depreciation=$682,400+$56,867=$739,267  

carrying value=cost-accumulated depreciation= $905000- $739,267 =$165,733  

gain on disposal=cash proceeds-carrying value

$13000=cash proceeds-$165,733  

cash proceeds=$165,733 +$13000=$ 178,733  

The combination of debt financing and equity financing that maximizes a firm's value is known as its:

Answers

Answer:

optimal capital structure

Explanation:

optimal capital structure can be regarded as a combination of

of debt and equity financing which brings about maximization of amarket value in a firm. It should be noted that optimal capital structure is the combination of debt financing and equity financing that maximizes a firm's value.

Other Questions
Helppp plzz!! A.) Side - Side - SideB.) Side - Angle - SideC.) Angle - Side - AngleD.) Angle - Angle - SideE.) Hypotenuse - LegF.) Not enough information. my picture please hahahahahahah Read the excerpt from The Dark Game: True Spy Stories from Invisible Ink to CIA Moles.Tension between the two sides escalated until June 1948, when the Soviets blocked all western access to the capital. In this first real crisis of the Cold War, the West was not going to be denied by the Soviets.If the underlined word were replaced with the word "event, the tone of the excerpt would bemore resentful.more intellectual.less intense.less objective. how might have the oppressive British rule influenced the ideas of the articles of confederation ? A collection of the same kind of cells working together to do the same job HELP PLEASE ASAP Read the excerpt from "On Becoming an Inventor" by Dean Kamen.When I was twelve years old and Barton, my older brother, was around fifteen, we took over the family basement. At first, I made a darkroom for developing pictures, and Bart was using it as his lab where he was raising about one hundred white rats, removing their thymus glands, and trying to figure out the glands' dysfunction. He wanted pictures taken of his experiment, doing the surgery on rats, and since I already had a darkroom, I took the pictures, though somewhat reluctantly. I didn't like the blood.What can you conclude about Barton from the excerpt?He was interested in solving medical mysteries at a rather early age.He did not understand why Dean would be squeamish about the blood.He went on to become a very famous and successful doctor.He had a severe dislike for rats and all other kinds of rodents. find the slope of the line passing through the points (-5,5) and (-5,-8) What is the unit rate of 232 people in 8 classrooms? i need help with this pleasee five men build a wall in 10 days how long will it take 10 men Anchara drops a penny from a height of 60 feet above the ground. The equation h=-16t^2 + 60 models the penbys height h i feet as a function of time t in seconds whatvare the solutions P3- is a(n) ______________________, so it ________________ valence electrons. Group of answ er choices anion, gained cation, gained cation, lost anion, lost The following DNA is being replicated and the origin of replication is in the middle of the sequence and marked with three stars ***. 5'ATCGGGCTACCCATGAAATGCTAGCATT***TAAGATCTTAAGCTAGCTAGTTCGATCTGA3'What is the sequence of the primer for the LEADING strand? Your answer should be 8 nucleotides long, written from 5' to 3' and only include the nucleic acid sequence (ex: ACTACTAC).note: there are two answers for this question A farmer's market is selling peaches for $2.00 a pound. If you buy 2 pounds, you save 10% on each pound. How much does it cost to get 2 pounds of peaches? 1. What right do education encompasses both entitlements and freedom?A. Right to free and compulsory primary educationB. Right the quality education in private schoolC. Right to choose yourteachersD. All of the above2. Which of the following is an example of non-formal education?A. Primary schoolingB. Senior high schoolC. Adult night classesD. Doctorate program El libro. _____ Libros. Approximately how many people are likely trafficked into the United States each year?5,5008,5008,50011,50011,500-14,500O 14,50017,500 She dove 75 feet under the sea To be eligible for Bright Futures, you must submit a statement explaining how all money will be repaid submit a plan of action for all courses throughout college take at least three remedial credits in the first semester take at least six non-remedial credits per semesterplease only answer if you know what your talking aboutand if your right i will give brainiest. What was the biggest drawback of Chinese block printing?