Compare and contrast two local government organizations. Include the similarities and differences among the executive, and legislative functions for each example.

Answers

Answer 1

Answer:

The legislative is communist, and the executive is socialist. They do not get along and the legislative functions to bring law and order while the executive branch tries to break the laws and change them.

Explanation:

Mark me brainliest please :D

Have a nice day!


Related Questions

Jane Doe is arrested for shoplifting. She claims that she is compelled to steal more and more each time because it is exciting to her. Experts would likely categorize her behaviors under which theory of crime:

Answers

Answer:

Kleptomania- is a psychological disease

where a person is compelled to perform an act of theif.

Which branch of the military requires their law enforcement officers to complete a Single Source Background Investigation (SSBI)?

OA. Navy
OB. Coast Guard
OC. Army
OD. Air Force

Answers

the navy
if not please correct me

Question: How does Vice President-elect Kamala Harris present a new image of political leadership?​

Answers

She is the first woman to be the Vice President of the United States and is also a person of color (:
Hope this helps you!

According to the video, what are some of the tasks Mechanical Engineers perform? Check all that apply.

researching
performing laboratory experiments
designing advertisements for a product
designing a product
debating
designing machines to make a product
selling a product

Answers

Answer: researching

designing a product

designing machines to make a product  selling a product

Explanation:

Mechanical engineers are professionals which can design and manufacture the machine using tools. Before production they undergo thorough research on materials that can become available for production, labor required, design and working of the machine. They design a machine in a way to sale it as a finished product. The mechanical engineers can produce aircraft engines, gas turbines, fuel cells, and machine tools.

answer:

a), researching

d), designing a product

f), designing machines to make a product

g), selling a product

The Ninth Amendment to the U.S. Constitution reads: The enumeration in the Constitution, of certain rights, shall not be construed to deny or disparage others retained by the people. What was the primary reason James Madison argued that it should be included in the Bill of Rights (the first ten amendments to the U.S. Constitution)

Answers

Answer: This amendment include rights of the people which have not been mentioned in the previous Constitutional amendments.

Explanation:

The ninth amendment of the united states constitution describes the rights of the people which were not specifically expressed in the Constitution earlier. Certain rights should not be deny or disparage from people. It reveals those rights which protect people from government infringement and some additional fundamental rights were also added to the constitution after this amendment. Thus these rights should be included in the Bill of Rights.

under Chief justice john marshall, surpreme Court descisions generally upheld alexander hamilton's belief that

Answers

Answer:

D. a loose interpretation of the Constitution could be used to increase federal power.

Explanation:

John Marshall was the Chief Justice of the Supreme Court of the United States from 1801 till his death in 1835. Without any prior study in law, he studied law in only just six weeks.

Under Supreme Court's decision under Chief Justice John Marshall upheld Alexander Hamilton's interpretation of the Constitution. Alexander Hamilton advocated broad and liberal interpretation of the Constitution. This belief was upheld by the Supreme Court under Chief Justice John Marshall. The Supreme Court uphelded a loose and liberal interpretation of the Constitution could be used to increase federal power.

Therefore, option D is correct.

Why are some forms of speech not protected by the First Amendment?

because they support different religious views

because they are expressed in writing


because they could cause harm to others

because they criticize the government

Answers

Because they could cause harm to others

When there is more than one judge, the group of judges is called

Answers

Answer:

Appellate :)

Explanation:

Answer:

in think the answer is panel

all contract are agreement but not all agreement are contract discuss​

Answers

A contract cannot be formed without an agreement. An agreement starts from a claim or an offer and ends on consideration though on the other hand, a contract has to be able to achieve another target through the agreement with both parties benefitting on the contract.

The quote sure is correct, is this what you needed by discussing on the topic?

Explain factors taken into consideration to determine the similarity of a name for it to be called “undesirable” under section 24 of the Companies Act (Chapter 24:03

Answers

Answer:

Explain factors taken into consideration to determine the similarity of a name for it to be called “undesirable”

Explanation:

registered under the Securities Act [Chapter 24:25] or in respect of a ... “secretary” includes any official of a company, by whatever name called, who ... nothing in this Act shall affect the v alidity of the incorporation of any existing ... (b) he considers to be in conflict with the provisions of this section or undesirable for any other.

what are the differences between rights and duties​

Answers

Answer:

rights are like you have freedom like its a law and duties are your job like your suppose to do it

Explanation:

Explanation:

The differences between rights and duties are as follows:-

RightRights are the opportunities, facilities or benefits obtained by a person from others.They are provided to the citizen.An example:- To get education is a right of students.

DutyThe works that we do for others' benefits are called duties.The are performed by the citizen.An example:- To obey teachers is a duty of students.

Ralph received an inheritance of $30,000 from his aunt’s estate. He then bought a used sports car from Sid and paid $25,000 cash. Shortly thereafter, Ralph realized that Sid had fraudulently misstated the car’s mileage, horsepower, and engine condition. At the same time, Ralph realized he needed $15,000 in cash to close a real estate deal. As a consequence, he took out a loan using the sports car as collateral. a) Could Ralph still avoid and rescind the contract for the purchase of the car? b) Could he take any other legal action against Sid?

Answers

a) Ralph could void and rescind the contract with Sid the car because of fraud.

He had already paid Sid the sum of $25,000 for the car, whose mileage, horsepower, and engine condition were fraudulently misstated.

b) Ralph could take legal action against Sid to recover value for the fraudulent misstatements.

Thus, Ralph should immediately sue Sid to void the contract or recover damages.

Learn more: https://brainly.com/question/10084927

What do terrorists' threats do to the ways private security and law enforcement officers apply Constitutional laws? (Check all that apply.)
They allow private security to use its own interpretation in some cases
They heighten the need to regulate the practices of these two agencies
They assure that the two agencies know how to work cooperatively in crises situations
They require sharing of key information

Answers

Answer:

1.4,2

Explanation:

The state of Texas enacts a law that prohibits Asian men from saying the word "God" on any day that is not Sunday. Discuss all of the potential Constitutional law violations that are at play with this law, and how they are at play based on the facts in the prompt.

Answers

Answer:

Never will i answer your quesTimon dolt

Explanation:

Why do firefighters need good vision so that it can be corrected to 20/20?
aids spatial awareness
tool handling
driving the engine
seeing in near darkness

Answers

seeing in near darkness or driving the engine

Does OSHA provide employees with insurance?

Answers

No bro God will bless you

Should lawyers be allowed to advertise

Answers

Answer:

Should lawyers be allowed to advertise

No they cant.lawyer advertising is partially protected by the First Amendment.

its is according to the country wise lawyer as in Nepal , india they cant but in US they can.

In some country ,lawyers are not conferred with the right to advertise and publicize their work, with the aim to solicit clients. In fact, there is a statutory prohibition.


Officers engaging the public with respectful treatment are
engaging people from all backgrounds.

Answers

Answer:

Officers engaging the public with respectful treatment are engaging people from all backgrounds. Political Parties have always existed in this country going back to the Federalist and Anti-Federalist. ty have held the most sway historically, they too have swung from conservative to liberal planks over time.

Explanation:

Some estimates indicate that corporate crime may cost society more than $389 billion dollars each year.
True
False

Answers

Answer:

This is true, corporate crime is difficult to prove, and difficult to discover.

what are the difference between civil law and criminal law?
any 8 points

Answers

Answer:

Civil law deals with the disputes between individual citizens, organizations, and government agencies, in which compensation is awarded to the victim. Examples are defamations like libel and slander, breach of contract, negligence resulting in injury or death, and property damage.

Criminal law deals with crime and the legal punishments that come with a criminal offense. A criminal prosecution involves the government deciding weather to punish and individual for either and act or an omission.

3+1
3+2
3+3
3+4
3+5
.............

Answers

Answer:4 ,5,6,7,8

Explanation:

Answer:

Explanation:

4

5

6

7

8

What is the definition of an act in law?

Answers

ACT, civil law, contracts. A writing which states in a legal form that a thing has been said, done, or agreed. In Latin, Instrumentum. Merl. Rep.

ACT. In the legal sense, this word may be used to signify the result of a public deliberation, the decision of a prince, of a legislative body, of a council, court of justice, or a magistrate. Also, a decree, edict, law, judgment, resolve, award, determination. Also, an instrument in writing to verify facts, as act of assembly, act of congress, act of parliament, act and deed. See Webster's Dict. Acts are civil or criminal, lawful or unlawful, public or private.

   2. Public acts, usually denominated authentic, are those which have a public authority, and which have been made before public officers, are authorized by a public seal, have been made public by the authority of a magistrate, or which have been extracted and been properly authenticated from public records.

   3. Acts under private signature are those which have been made by private individuals, under their hands. An act of this kind does not acquire the force of an authentic act, by being registered in the office of a notary. 5. unless it has been properly acknowledged before the officer, by the parties to it.

A bill which has passed through the various legislative steps required for it and which has become law. Related Terms: Statutes, Legislation, Law, Regulation, Enactment, Bill. Synonymous with the term enactment or statute.

Liberal constructionists want Congress to _____.
restrict the war powers of the President


create new powers, as needed, over time


only use the powers expressed in Article I


interpret executive and judicial decisions

Answers

Answer:

last option

Explanation:

A person with a strict interpretation of the constitution wants the government to only perform the powers given to them in the constitution. If the constitution does not explicitly give the power to an individual or group (like the President, Congress, or the Supreme Court) than that group/individual can not perform that duty.

On the other hand, those individuals who think that the constitution is flexible and that some powers can be "assumed" would fall under the category of having a loose interpretation of the constitution.

Interpret executives and judicial decisions

Drag the tiles to the correct boxes to complete the pairs.
Match the panel members with the correct UCMJ procedure.


A: commanding officer

B:panel of at least three military officers

C:panel of three to five
military officers

D:one presiding officer


——————————————

A. summary court-martial

B. special court-martial

C. general court-martial

D. non-judicial punishment

Answers

The panel members and the correct UCMJ procedures when matched correctly would look like:

Commanding officer -  non-judicial punishment.Panel of at least three military officers - special court-martial.Panel of three to five military officers - C:panel of three to fivemilitary officers.One presiding officer - Summary court-martial.

How are UCMJ procedures conducted?

A commanding officer can give out a non-judicial punishment as is their right for offences that they can punish. A special court-martial will require that at least 3 officers preside with a military judge.

A general court martial will involve a panel of between three and five military officers and a military judge while a summary court-martial involves a single presiding officer.

Find out more on court martials at https://brainly.com/question/1090190.

The HIPAA regulations provide a federal floor for healthcare privacy and security standards and do NOT override more strict state laws which potentially requires providers to support two systems and follow the more stringent state law.

Answers

State whether the given statement is true or false.

The HIPAA regulations provide a federal floor for healthcare privacy and security standards and do NOT override more strict state laws which potentially requires providers to support two systems and follow the more stringent state law.

Answer: TRUE

Explanation:

The health insurance portability and accountability act was developed in 1996. It is a federal law. It promotes the creation of standards that are accepted nationally that aids in protecting the sensitive health of the patient. Such information includes the expense of medical treatment, medical insurance cover taken by the patient, type of disease and other confidential information. Such information is not disclosed to any other person without patient's agreement. This assures complete healthcare privacy to patients. The security standards must not override the state laws. The state laws and state jurisdiction also required to follow the HIPAA regulation.

Question 4 of 10
In what way have laws about sexual orientation impacted HR management?
A. It means HR managers must work to close the wage-gap
throughout an organization.
B. It means HR managers must create policies that prevent
discrimination.
c. It means HR managers must provide work visas to all employees.
D. It means HR managers must prepare for an increasingly aging
workforce.
SUBMIT

Answers

It means HR managers must work to close the wage-gap throughout an organization in the way have laws about sexual orientation impacted HR management. Thus, option (a) is correct.

What is management?

The term “management” refers to the act of managing. The management of the business activities. Management is the basis of art, science, and the profession. Management are they manage the organization. Management are based of the different functions are the step by step.

According to the HR management, is the department of the organization. The HR management was the main work to the hiring and the firing. There were the laws on the sexual orientation impacted HR managers must work to close the wage-gap throughout an organization.

As a result, the HR managers must work to close the wage-gap throughout an organization in the way have laws about sexual orientation impacted HR management. Therefore, option (a) is correct.

Learn more about on HR management, here;

https://brainly.com/question/25806768

#SPJ5

How would change the power of the president with a constitutional amendment? Should the presidency have more or less power? Explain.

Answers

Answer:

why would you change the power of the president? is this a test or quiz question, because if so I can answer it

Explanation:

Joseph, a lead crime scene investigator, assigns a square area to each investigator to collect evidence. Which crime scene search pattern is he using?

Answers

Joseph is using the "zone" method crime scene search pattern. This method is best for indoor crime scenes such as living rooms and bedrooms.

what are some qualities Electrical Engineers need? Check all that apply.

knowledge of life sciences
attention to detail
understanding of government guidelines
knowledge of computers and electronics
aptitude for problem solving
ability to convince and persuade others
negotiation skills

Answers

Answer: attention to detail

understanding of government guidelines

knowledge of computers and electronics

aptitude for problem solving

Explanation:

Electrical engineers are the engineers that are responsible for designing, developing, electrical equipment, that are manufactured.

Some qualities that electrical engineers must have include the fact that they must be able to pay attention to details, have knowledge of computers, understand government guidelines and be able to solve problems.

Answer:

b c d e

Explanation:

is correct pros to guy above me

3. Identify the appropriate healthcare legal terminology from the scenario. a. Mrs. Barbara White - PLAINTIFF b. Dr. Gilchrist and Richmond Medical Center - DEFENDANT c. Court issued order requiring the nurse to appear at the trial - d. Deciders of fact e. Pretrial exchange of documents between lawyers f. Pretrial oral testimony g. Electronic documents h. Statement at trial

Answers

Answer:

This would be a Malpractice suite.

Barbara White is an accomplished singer, actress, and teacher. She sang with the Tabernacle Echo Choir and the Harmonizing Angels and directed the choir at Little Zion Baptist Church in Nokesville, Virginia, for over 30 years.

Who is Barbara White?Maddie Sperle's Chapter 4 Assignment (M1A3) Mrs. Barbara White was brought to Richmond Medical Center for hip replacement surgery.According to Dr. Gilchrist's standing orders, she was given a prophylactic medicine before surgery to help prevent stomach problems afterward.Mrs. White's drug allergy, which was noted in her medical record, was unfortunately overlooked by the staff despite her presence. When the error was discovered, Benadryl was given to replace the incorrect prescription, but this caused a sharp drop in her blood pressure, which led to a stroke. Mrs. White had dysphasia and hemiplegia, both of which she still has today.

To learn more about 'Barbara White' refer to

https://brainly.com/question/28872493

#SPJ2

Other Questions
A businessman wants to buy a truck. The dealer offers to sell the truck for either $120,000 now, or six yearly payments of $25,000.What is the interest rate being offered by the dealer in percentage (rounded to the closest integer number) 30 POINTS HELP Which idea was supported by Aristarchus, Copernicus, and Galileo?The planets have epicycles.The planets revolve around the Sun. The stars rotate around the Sun.The center of the solar system is Earth. The belief that Europeans are the superior class in society is called? Question 1 of 11What are two ways space exploration can improve international relations?DA By urging countries to compete to achieve goalsDB. By helping countries' economies grow weakerDC. By encouraging countries to share scientific dataDD. By inspiring countries to work together to solve problems explain the ides behind majority rule and minority rights 3. Study the changes in population graph, what % lived in cities by the 1930's?By the 1970's? What led the people of France to agree to an imperial dictatorship instead of a true democratic republic like the one selected in the American colonies? why human are not responsible for global warming? Which of the following cells can generate ATP through glycolysis? A. Eukaryotic Cells (Plants and Animals) B. Prokaryotic Cells (Bacteria) C. None of the above D. All of the above What is the length of EF in the right triangle below? Choose one of the three themes (social oppression, greed, or good vs. Evil) and explain something you know about it in the real world OR explain where else you have seen the theme (a book, movie, show, etc.) Please help quick What is f(2) if f(x) = 2x-5 and f(4) if f(x) = -3x + 15step by step please! Solve.Okay here is 20 letters brainy Please which one is the right answer Please help with this What is public participation? Why is itnecessary for environmental conservation AUUUAACUGUUCUGUCUAGAG1. Construct an Explanation Based only on the information provided, why could themRNA section be translated into three different sets of amino acids, instead of just oneset?2. Use Models Use the genetic code to translate the sequence into each of the threepossible sets of amino acids.3. Draw Conclusions Which of the three sets of amino acids is the most likely to beincluded in the polypeptide? Explain your reasoning. Please help me with this homework Different cities have different sales tax rates. Here are the sales tax charges on the same items in two different cities.Complete the tables. 50 points brainliest I'm watching to wait explain the difference between essential body fat and storage body fat