Esmeralda works in the snack bar at the movie theater. She serves popcorn in two sizes, small and giant. The dimensions of the small box of popcorn are similar to the dimensions of the giant box of popcorn 15 in. 4 in 6 in 10 in. Small Popcom Giant Popcorn What is x when the width of the small box is 4 inches? Round your answer to the nearest tenth?​

Esmeralda Works In The Snack Bar At The Movie Theater. She Serves Popcorn In Two Sizes, Small And Giant.

Answers

Answer 1

Answer:

6.7

Step-by-step explanation:


Related Questions

Find each percent decrease. Round to the nearest percent. From 126 ounces to 48 ounces

Answers

I'm stuck on the same thing soo this is kinda weird that I'm typing  

Step-by-step explanation:

sorry for not answering the answer ;)

Answer:

There is 61.9% decrease in the value from 126 ounces to 48 ounces.

what is the weight of a square if a triangle weighs 4 grams? explain your reasoning

Answers

Answer:5

Step-by-step explanation:

yh thereu go

Answer:

8 grams

Step-by-step explanation:

u add 2 triangles

hi can anyone help me pls, thx. ​

Answers

Answer:

24,28,32,36,40,.....

Step-by-step explanation:

It’s multiples of 4

Answer:

[tex]a_{n}[/tex] = 4n + 4

Step-by-step explanation:

There is a common difference d between consecutive terms in the sequence.

d = 12 - 8 = 16 - 12 = 20 - 16 = 4

This indicates the sequence is arithmetic with n th term

[tex]a_{n}[/tex] = a₁ + (n - 1)d

where a₁ is the first term and d the common difference

Here a₁ = 8 and d = 4 , then

[tex]a_{n}[/tex] = 8 + 4(n - 1) = 8 + 4n - 4 = 4n + 4

membership to iron gym cost $40 per month plus $30 registration fee. the monthly cost is deducted automatically from your account. if your starting balance is $350 how many months will you be able to go to the gym before you have to add money to your account?
A. 6
B. 7
C. 8
D. 9

Answers

Answer:

C. 8

Step-by-step explanation:

8 x 40 = 320$ plus 30$ fee is 350

Answer:

8

Step-by-step explanation:

40x 80=320

320+30=350

Is this a function or not?

Answers

Answer:

Your answer should be function.

Step-by-step explanation:

Its a function because each input has an output.

Answer:

Not a function.

Step-by-step explanation:

A is the 1st letter in the alphabets.

C is the 3rd letter.

But D is the 4th not the 5th.

What is the domain and range please?

Answers

Answer:

range -5 ≤ y ≤ 3

domain -5 ≤ x ≤ 3

Step-by-step explanation:

please help me plzzz

Answers

Hi there! Your answer will be 45 Degrees,

This is because when the top line is facing C in this case and the bottom line is facing B it would be a 90° angle. Due to it being less than 90°, and it can not be a decimal your only choice would be 45°.

The only reason it is not 180° is because when 180° is shown it will go from A to B and show a straight line.

I hope this helped!

F(x)=x^2-x^3 find the value of f(-2)

Answers

The Correct answer is 3

Explanation:

Using the defined function, f(a) will produce the same result when substituted for x:

F(x)=x^2-x^3

Setting this equal to 4, you can solve for a:

a2 – 5 = 4

a2 = 9

a = –3 or 3

please explain this to me and say the answer!! ASAP!!!

Answers

Here....see the attachment...
Hope this helps ^^

A water slide starts at (0,144) and ends at (12,0) what is the slope of the slide

Answers

Answer:

-12

Step-by-step explanation:

The slope of a line is just the difference of y-values divided by the difference of x-values

[tex]m = \frac{y_2-y_1}{x_2-x_1} = \frac{144-0}{0-12} = \frac{144}{-12} = -12[/tex]

Solve the following equation for a.
n=b/a+3.

a=

Answers

Answer:

the answer is a=b/n-3

Step-by-step explanation:

Isolate the variable by dividing each side by factors that don't contain the variable.

What is the slope of the line on the graph?

Answers

Answer:

Pick two points on the line and determine their coordinates. Determine the difference in y-coordinates of these two points (rise). Determine the difference in x-coordinates for these two points (run). Divide the difference in y-coordinates by the difference in x-coordinates (rise/run or slope).

In a sale, a blow dryer is marked down from $18.98 to $11.39.
What is the percent decrease?

Answers

The answer is: 40%

Hope this helps!

The percent decrease is 61.94%.

What is a percentage?

A ratio or value that may be stated as a fraction of 100 is called a percentage. And it is represented by the symbol '%'.

Given:

In a sale,

a blow-dryer is marked down from $18.98 to $11.39.

Let n be the percent decrease.

So,

n = 11.39 x 100/18.39

n = 61.94

Therefore, the required percentage is 61.94%.

To learn more about the percentage;

https://brainly.com/question/24159063

#SPJ2

i need the answer for this question

Answers

Answer:

x=5

y=7

(5,7)

Step-by-step explanation:

solved by substitution.

Solve for missing angle

Answers

Answer:

100

Step-by-step explanation:

180-160 = 20

20+60=80

180-80= 100

it's opposite so the answer is 100

Answer:

the answer is 100° because a triangle is a total of

180° and a straight line is also 180° so 180-160=20

and 60+20=80

and 180 -80 = 100 and the angle your looking for is a opposite from the angle that you just found

Stu hiked a trail at an average rate of 3 miles per hour. He ran back on the same trail at an average rate of 5 miles per hour. He traveled for a total of 3 hours.

Which equation can be used to find the time it took Stu to hike the trail?

3t = 5
3t = 5(3 – t)
3 + t = 5 + (3 – t)
3t + 5(3 – t) = 3

Answers

Answer:

The correct answer:

B.) 3t = 5(3 – t)

Step-by-step explanation:

Drag each tile to the correct cell in the table.

Trip to end of trail — 3,   t,   3t

Trip back — 5,   3 - t,   5(3 - t)

Tap the THANKS button and RATE ⭐️

(If helpful)

Answer:

b

trip to end: 3,    t,   3t

trail back: 5,    3-t,     5(3-t)

Step-by-step explanation:

edge 2021

PLEASE HELP ME :(
Leah would like to earn at least $120 per month. She babysits for $5 per hour and works at an ice cream shop for $8 per hour. Leah cannot work more than a total of 20 hours per month. Let x represent the number of hours Leah babysits and let y represent the number of hours Leah works at the ice cream shop.

Which pair (x, y) represents hours that Leah could work to meet the given conditions? Select all that apply.

A.
(2.5, 15)

B.
(5, 20)

C.
(7.5, 12.5)

D.
(17.5, 5)

E.
(19, 1)
*giving brainliest to whoever answers correctly*

Answers

Answer:

i think its b

Step-by-step explanation:

Answer:

It’s c and e

Step-by-step explanation:

fugg is yu talking bout

The standard deviation of the following data set is 0.31. 68% of the data would fall in which range?
4.3, 5.1, 3.9, 4.5, 4.4, 4.9, 5.0, 4.7, 4.1, 4.6, 4.4, 4.3, 4.8, 4.4, 4.2, 4.5, 4.4

Answers

Answer:

Pr(4.19 ≤ X ≤ 4.81)

Step-by-step explanation:

First of all, let's calculate the mean;

x¯ = (4.3 + 5.1 + 3.9 + 4.5 + 4.4 + 4.9 + 5.0 + 4.7 + 4.1 + 4.6 + 4.4 + 4.3 + 4.8 + 4.4 + 4.2 + 4.5 + 4.4)/17

x¯ = 76.5/17

x¯ = 4.5

We are given standard deviation; s = 0.31

Now, z-value for a 68% Confidence interval is 1

Range in which the data falls is;

Range = x¯ ± zs

Range = 4.5 ± (1 × 0.31)

Range is;

Pr[(4.5 - 0.31) ≤ X ≤ (4.5 + 0.31)]

Pr(4.19 ≤ X ≤ 4.81)

Answer:

Pr (3.57 ≤ X ≤ 5.43)

Step-by-step explanation:

X=8,y = 10 find y when x = 68

Answers

70? I think that’s it

Answer:

85

Step-by-step explanation:

x:y

8:10

68:y

divide 68 by 8 u get 8.5 and the times it by 10

so y equals 85

14
A canteen spends money on food and drink in the ratio of 29:3
In total, they spend £6496.
Find how much money they spend on drink.​

Answers

Answer:

Money spend on drink  = £ 609

Step-by-step explanation:

Food : drink = 29 : 3

Money spend on food = 29x

Money spend on drink = 3x

Total money spend = 29x + 3x = 32x

32x = £6496

   x = 6496/32

  x = £ 203

Money spend on drink = 3x = 3 * 203 = £ 609

Answer:

who knows the answer if u know the answer pls tell


PLEASE ANSWER QUICK!!!
Select the correct answer.
Four-thirds times the sum of a number and 8 ls 24. What is the number?
Ο Α. .
40
OB.
26
Ос. .
24
OD.
10

Answers

Answer:

D is the 10 is the answer

the answer is d. 10

4/3(x+8)=24 is the equation

which list below shows the fractions in oreder from least to greatest
2/14, 4/7, 5/9, 5/8,
5/8, 4/7, 5/9, 2/13,
2/13, 4/7, 5/8, 5/9,
2/13, 5/9, 4/7, 5/8

Answers

Understand which fraction is smallet

Its A because i checked myself

Find the slope and the y-intercept of the graph of the linear equation.
y+7=5/4x
The slope is
and the y-intercept is

Answers

Answer:

your slope would be 5/4

Step-by-step explanation:

your x will always be your slope. when you rewrite the equation it would be

y=5/4x-7

so from -7 you would go up 5 and over 4.

Again your x value will always be your slope.

7.45 x 103 = ___

7.45
74.5
7,450
74,500

Answers

Answer: 745

Step-by-step explanation:

[tex]7.45 \times 10^{3}=7.45(1000)=\boxed{745}[/tex]

hi , how to do 14? :)

Answers

Answer:

l think because the base of ax and a² is same we can write x=2..and the same thing is applied in by and b⁵.

Someone please help!
Remember you’ll get brainlest 3/5

Answers

Answer: C

Step-by-step explanation:

C. Sqrt18, 9, 4pi, 14

What is the slope?
у
-2
3
-1
0
1
1
3
2
5

Answers

Answer:

Slope = 2

Step-by-step explanation:

5-3

over

2-1 is

2 over 1 which is slope of 2

Solve for x. what is x-5=15​

Answers

Answer:

x=20

Step-by-step explanation:

Answer:

x=20

Step-by-step explanation:

20-5=15

(Will mark brainliest and give $5 Starbucks digital card Include SC!!!) For which set of triangles can you immediately use the AAS congruence criteria to prove them congruent?(1 point)
1. triangles STU and VWX, where ∠T≅∠W, ∠U≅∠X, and SU≅VX

2. triangles GHI and JKL, where ∠G≅∠J, ∠H≅∠K, and GH≅JK

3. triangles MNO and PQR, where ∠N≅∠Q, MN≅PQ, and NO≅QR

Answers

Answer:

the second one

Step-by-step explanation:

Can you explain the notation T(0,16)?

Answers

Answer:

The decimal place accuracy of a number is the number of digits to the right of the decimal point. The decimal point is a period written between the digits of a number. If there is no decimal point, it is understood to be after the last digit on the right and there is no place (zero place) accuracy.

The significant digits of a number are those digits that are most accurate. If a number has no place accuracy and there is no string of zeroes ending the number on the right, all the digits are significant. If a number has no place accuracy and there is a string of zeroes ending the number on the right, the significant digits are those digits to the left of the string of zeroes. If a number has a decimal point, the significant digits are the digits starting from the first non-zero number on the left to the last digit written at the right end. In either case the number of significant digits is just the count of these digits.

Decimal notation is the regular written format for a number. Scientific notation of a number just writes the significant digits followed by an appropriate power of ten.

The most common form of scientific notation inserts a decimal point after the first significant digit, follows the significant digits with times, "x", and then 10 to a power. If the original number is at least one, the power is the number of digits between the decimal point and the first number on the left. If the number is less than one, the power is the negative of the number of digits to the right of the decimal point up to and including the first non-zero number.

Calculators and computer software sometimes write scientific notation with the significant digits followed by the letter "E" and then the power of 10, without writing the base. A decimal point is usually inserted after the first significant digit.

Step-by-step explanation:

Other Questions
HELP PLEASE ASAP Read the excerpt from "On Becoming an Inventor" by Dean Kamen.When I was twelve years old and Barton, my older brother, was around fifteen, we took over the family basement. At first, I made a darkroom for developing pictures, and Bart was using it as his lab where he was raising about one hundred white rats, removing their thymus glands, and trying to figure out the glands' dysfunction. He wanted pictures taken of his experiment, doing the surgery on rats, and since I already had a darkroom, I took the pictures, though somewhat reluctantly. I didn't like the blood.What can you conclude about Barton from the excerpt?He was interested in solving medical mysteries at a rather early age.He did not understand why Dean would be squeamish about the blood.He went on to become a very famous and successful doctor.He had a severe dislike for rats and all other kinds of rodents. find the slope of the line passing through the points (-5,5) and (-5,-8) What is the unit rate of 232 people in 8 classrooms? i need help with this pleasee five men build a wall in 10 days how long will it take 10 men Anchara drops a penny from a height of 60 feet above the ground. The equation h=-16t^2 + 60 models the penbys height h i feet as a function of time t in seconds whatvare the solutions P3- is a(n) ______________________, so it ________________ valence electrons. Group of answ er choices anion, gained cation, gained cation, lost anion, lost The following DNA is being replicated and the origin of replication is in the middle of the sequence and marked with three stars ***. 5'ATCGGGCTACCCATGAAATGCTAGCATT***TAAGATCTTAAGCTAGCTAGTTCGATCTGA3'What is the sequence of the primer for the LEADING strand? Your answer should be 8 nucleotides long, written from 5' to 3' and only include the nucleic acid sequence (ex: ACTACTAC).note: there are two answers for this question A farmer's market is selling peaches for $2.00 a pound. If you buy 2 pounds, you save 10% on each pound. How much does it cost to get 2 pounds of peaches? 1. What right do education encompasses both entitlements and freedom?A. Right to free and compulsory primary educationB. Right the quality education in private schoolC. Right to choose yourteachersD. All of the above2. Which of the following is an example of non-formal education?A. Primary schoolingB. Senior high schoolC. Adult night classesD. Doctorate program El libro. _____ Libros. Approximately how many people are likely trafficked into the United States each year?5,5008,5008,50011,50011,500-14,500O 14,50017,500 She dove 75 feet under the sea To be eligible for Bright Futures, you must submit a statement explaining how all money will be repaid submit a plan of action for all courses throughout college take at least three remedial credits in the first semester take at least six non-remedial credits per semesterplease only answer if you know what your talking aboutand if your right i will give brainiest. What was the biggest drawback of Chinese block printing? In a perfectly insulated container of negligible mass, 4.00 102 kg of steam at 100C and atmospheric pressure is added to 0.200 kg of water at 50.0C. A) If no heat is lost to the surroundings, what is the final temperature of the system? B) At the final temperature, how many kilograms are there of steam and how many of liquid water? What is the importance of the Battle of Khanua and Chaunsa? VocabularyMake a sentence using these two wordsdedicated, obstaclecollaborate, techniques 3) Complete the sentences. Use the Past Simple or the Present Perfect Simple form of the verbs in brackets1 Marry_____(win) the lottery last year.2 I _____(not see) anyone yet.(come/just) home.4. They____(buy) the car two years ago5. William still____(not buy) the present for his sister 4 Complete the sentences. Use the Present Perfect Simple or the Present Perfect Continuous form of the verbs inbracts1. The baby's face is really dirty. What____(he/eat)?2. Like____(never/be) abroad3. Eva is exhausted these days. She______(work) too hard recently.4.______(you/finish) your homework yet?5. I_____(clean) all morning I'm really tired! 6x = 10y - 10x + y + 7 = 0What is x and y?