Factor the expression.
2x + 8

Factor The Expression.2x + 8

Answers

Answer 1

Answer:

2x+8

2 is common

2(x+4)=0

Step-by-step explanation:


Related Questions

Your mother gave you $13.32 with which to buy s present. This covered 3/5 of the cost. How much did the present cost?​

Answers

Answer:

The cost of the present is $22.20

Step-by-step explanation:

1. 5(2x + 1) = 35
I need help what’s the answer showed work

Answers

Answer:

x=3

Step-by-step explanation:

5(2x+1)=35

Step 1: Simplify both sides of the equation.

5(2x+1)=35

(5)(2x)+(5)(1)=35(Distribute)

10x+5=35

Step 2: Subtract 5 from both sides.

10x+5−5=35−5

10x=30

Step 3: Divide both sides by 10.

x=3


¿Cómo las razones de seno y cos
eno son semejantes?​

Answers

Las razones de los lados de un triángulo rectángulo se llaman razones trigonométricas.

Espero te ayude :)

Eugene had $24 to spend on three pencils.
After buying them he had $18. How
much did each pencil cost?


2 dollars for each pencil​

Answers

Answer:

Two dollars each

Step-by-step explanation:

Answer:

6/3 is 2. That's the total cost of each pencil.

Step-by-step explanation:  

Write an integer that represents spending $40

Answers

Answer:

-40

Step-by-step explanation:

you are subtracting 40.

Find the slope and the y-intercept of the line.
y=-1/2x+8 PLS HEEEEEEEEEEEEEELP

Answers

Answer:

slope: -1/2

y-intercept: 8

Step-by-step explanation:

y=mx+b is the linear equation

m=slope

b=y-intercept

Nicholas bought 24feet of fabric at afabric store. The fabric cost $1.35 per foot, including sales tax. If Nicholaspaid with a $50bill, how much change should he have received?

Answers

Answer:

24x1.35=32.4

He should have recieved $32.40 in change.

Is 14/9 greater than 2

Answers

Answer:

No

Step-by-step explanation:

14/9ths is not greater than two because 9 two times is greater than fourteen.

Answer:

No

Step-by-step explanation:

Because, 14/9 is equal to 1.555.... and 1.555.... is less than 2.

Hope I helped!!

Sorry if its wrong! :(

Pls mark brainlist!!!

Translate this sentence into an algebraic inequality.
3 more than the product of x and 12 is less than 25.
Select one:
a. 12x + 3 < 25
b. 3 > 12x – 25
c. 3 > 12(x - 25)

Answers

Answer:

Option A

Step-by-step explanation:

Lets convert each sentence into algebric inequality.

3 more than product of x & 12 :-

[tex] = > 12x + 3[/tex]

Now , 12x + 3 is less than 25 :-

[tex] = > 12x + 3 < 25[/tex]

Solve the equation: 3(x + 2) = 40.2 *
please help

Answers

Answer: x=11.4

Step-by-step explanation:  3(x+2)=40.2

(3)(x)+(3)(2)=40.2

3x+6=40.2

3x+6−6=40.2−6

3x=34.2

3x /3 = 34.2 /3

x=11.4

Find the slope of the line that goes through the points (2,5) and (3,-2)

Answers

Answer:

the slope is -7

Step-by-step explanation:

[tex]\frac{-2-5}{3-2} =\frac{-7}{1}[/tex]

Please Help me! 15 Points!
Which expressions are equivalent to 2(b + 3c) ?
A: 3(b+2c)
B: (b + 3c) + (b + 3c)
C: 2(b) + 2(3c)

Answers

B. (b+3c)+(b+3c)

C. 2(b)+2(3c)

Step by Step instruction :)))

we have

2 (b+3c)

Distribute the number 2

2(b+3c) = 26 + 2(3c) = 26 + 6c

Verify each case

Case A) 3(b+2c)

distribute the number 3

3(b + 2c) = 36 + 3(2c) = 36 + 6c

3b + 6c is NOT equal to 2b + 6c

therefore

Choice A is not equivalent to the given expression

Case B) (b+3c)+(b+3c)

Combine like terms

b + 3c) + (b + 3c) = (b + b) = 3c + 3c = 26 + 6c

2b + 6c = 26 + 6c

therefore

Choice B is equivalent to the given expression

Case C) 2(b)+2(3c)

Multiply both terms by 2

2(b) + 2(3c) = 2b + 6c

2b + 6c = 26 + 6c

therefore

Choice C is equivalent to the given expression

Hope it helps

Answer:

B. (b+3c)+(b+3c)

C. 2(b)+2(3c)

Step by Step instructions:

we have

2 (b+3c)

Distribute the number 2

2(b+3c) = 26 + 2(3c) = 26 + 6c

Verify each case

Case A) 3(b+2c)

distribute the number 3

3(b + 2c) = 36 + 3(2c) = 36 + 6c

3b + 6c is NOT equal to 2b + 6c

therefore

Choice A is not equivalent to the given expression

Case B) (b+3c)+(b+3c)

Combine like terms

b + 3c) + (b + 3c) = (b + b) = 3c + 3c = 26 + 6c

2b + 6c = 26 + 6c

therefore

Choice B is equivalent to the given expression

Case C) 2(b)+2(3c)

Multiply both terms by 2

2(b) + 2(3c) = 2b + 6c

2b + 6c = 26 + 6c

therefore

Choice C is equivalent to the given expression

1. The cheerleading squad is selling hot dogs and cookies for a fundraiser. The cost of each hot dog is $1.50 and the cost of each cookie is $0.75. How many hot dogs and cookies can a person buy with less than $15?

Answers

Answer:

5 hot dogs and 9 cookies

Step-by-step explanation:

1.5(5)+0.75(9)<15

7.5+6.75=14.25

The ratio of boys to girls in a group is 7:2. If there are 60 more boys than girls, work out how many girls there are.

Answers

Answer:

Step-by-step explanation:

So, kids are divided into 8 total parts.

7 - 1 = 6 more parts that are boys. The 48 extra boys are those 6 parts.

48/6 = 8 boys per part

All parts have the equal number of kids, so one part girls also has 8.

There are 8 girls (and 56 boys. 8:56 = 1:7).

Can someone help me please

Answers

i think that it should be A sorry if it’s wrong.

The following data points represent the length of each song Roy the Rooster sang each morning since he
changed barns.
2.2, 5.1, 5.7, 8.2, 2.2, 7.4. 4.3. 5.6
Using the data, create a histogram.
7
6
5
4
Number of mornings
3
More and
You

Answers

Answer:

Step-by-step explanation:

So put the 0-3 to the y2, 3-6 to the y4 and 6-9 to the y2


What is the ratio of the calories Robyn
burned on Wednesday to the calories she
burned on Monday?
A. 4:3
B. 3:2
C. 5:3
D. 5:4

Answers

The ratio is c I hope this help you

Answer:

Step-by-step explanation:

7

The length of a ship is 247 metres, correct to the nearest metre.
Write down the minimum length of the ship.

Answers

Answer:

246.50

Step-by-step explanation:

a hockey team scored the following number of goals in their last 5 games: 2,3,5,3,2 which is the mean absolute deviation of the number of goals?

Answers

should be 5 because it’s in the middle

The required mean absolute deviation of the number of goals is 0.8.

What is mean?

The mean of the values is the ratio of the total sum of values to the number of values.

The mean absolute deviation of the number of goals is a measure of how far the individual scores deviate from the mean (average) score.

To find the mean (average) score:

Mean = (2 + 3 + 5 + 3 + 2) ÷ 5 = 15 ÷ 5 = 3

Next, we find the absolute deviation for each score:

Absolute deviation for score 2: |2 - 3| = 1

Absolute deviation for score 3: |3 - 3| = 0

Absolute deviation for score 5: |5 - 3| = 2

Absolute deviation for score 3: |3 - 3| = 0

Absolute deviation for score 2: |2 - 3| = 1

Mean absolute deviation is given as,
= (1 + 0 + 2 + 0 + 1) ÷ 5 = 4 ÷ 5 = 0.8

So, the mean absolute deviation of the number of goals is 0.8.

Learn more about mean here:

https://brainly.com/question/15397049

#SPJ5

Mark tried to pour 36 ounces of tea into 3 cups. after filling the cup to the top, there were still 13.5 ounces left in his tea pot. if each cup is the same size how much is in the tea cup? HELP PLEASE!

Answers

Answer:

its 12

Step-by-step explanation:

12 oz

Answer:

22.5/3

Step-by-step explanation:

Hey, the idea is to set up an equation that you can solve

36 ounces of tea = 3 cups(some ounces of tea) + 13.5 ounces left

Now just solve for how much tea is in each cup.

36-13.5 = 3(X)

3X = 22.5

x = 22.5/3

Evaluate (-A) to the second powerfor A = 5, B = -4, and C = 2.
-5
0-25
025

Answers

Answer:

-4

Step-by-step explanation:

The cost of renting a boat at a lake is $35 per hour plus $5 for life jackets. Write an
• equation in slope-intercept form that can be used to calculate the total amount you would pay for
renting a boat. (assume only you need a life jacket)

Answers

Answer:

y = 35x + 5

Step-by-step explanation:

Slope-intercept form is y = mx + b

m is the slope, b is the constant, or y-intercept.

In this case, 5 is our constant. You pay a one-time fee of $5 for a life jacket. This price doesn't change nor do you have to pay it again, so this is your constant.

35 is our slope. 35 represents the $35 you pay for each hour with the boat. This is our slope because it will change overtime, based on x, or the number of hours you are renting the boat.

y is the total cost, since you have to add up $35 times the number of hours you are renting, plus the $5 for the life jacket.

37.
An express train travelled at a certain average speed from Town X to Town Y which was
150 km away. It then continued its journey to Town Z at an average speed 20 km/h faster than
its initial average speed. Town Ywas 200 km from Town Z. If it took the same time to travel for
both parts of the journey, what was the train's average speed for the first part of the journey?​

Answers

Answer:

60 km/hr

Step-by-step explanation:

Let the speed at the initial average speed from Town X to Town Y be a.

We are told that it journeyed to Town Z at an average speed 20 km/h faster than its initial average speed. Thus, its average speed here is (a + 20) km/hr.

Town Y was 200 km from Town Z.

Thus, time spent here is;

t_2 = 200/(a + 20)

Time from X to Y is; t_1 = 150/a

We are told that it took the same time to travel for both parts of the journey.

Thus; t_1 = t_2

150/a = 200/(a + 20)

Cross multiply to get;

150(a + 20) = 200a

150a + 3000 = 200a

200a - 150a = 3000

50a = 3000

a = 3000/50

a = 60 km/hr

(-10,-7) (-8,1) find the distance between the two points show work.

Answers

Answer:

8.25

Step-by-step explanation:

(-10,-7) (-8,1) find the distance between the two points show work.

The formula for calculating the distance between the two points is expresses as;

D = √(x2-x1)²+(y2-y1)²

D = √(-8+10)²+(1+7)²

D = √(2)²+8²

D = √4+64

D = √68

D = 8.25

Hence the distance between the two points is 8.25

с
For the diagram shown, select the angle pair that
represents each angle type.
Corresponding angles
b
1/2
5
CO
910
Altemate exterior angles
A
3
4
7
8
1112
Alternate interior angles
Vertical angles

Answers

Answer:

For the diagram shown, select the angle pair that represents each angle type.

Corresponding angles

✔ D. angle 7 and angle 3

Alternate exterior angles

✔ C. angle 12  and angle 5

Alternate interior angles

✔ D. angle 2 and angle 11

Vertical angles

✔ C. angle 7  and angle 6

Step-by-step explanation: cus I did it on Edge 2021 and these were the answer...just trust me :)

Lmk this answer ASAP please

Answers

Answer:

angles on a line add up to 180 degrees

180 - 40 = 140

180 degrees in a triangle. going to work out the base angles for the isosceles triangle as its top angle is 140 degrees.

180 - 140 = 40

base angles are equal so 40/2 = 20 degrees

X = 20 degrees

90 degrees angle has been indicated.

90-20 = 70

180 - 70 - 40 = 70

y = 70 degrees

1. Simplify -3(2x+4)-2
6х+12
-5x-9
-6х-14
-X-2

Answers

Answer:

-6x-14 is the answer. Thx.

Step-by-step explanation:

-3(2x+4)-2

6x-4-2

6x-6

What is the difference between a system of equations and a system of inequalities?
(Pls help man it’s worth like 25 points im desperate because I have no brain)

Answers

Answer:

"The solution(s) of a system of linear equations give points of intersection of specific lines or planes. The solution(s) of a system of linear inequalities give areas of intersection wherein any specific pair of points or lines are solutions. PROCESS-WISE there are little differences between solving systems."

Step-by-step explanation:

www.algebra.com

When buying a car, Esther can choose a 2-door or 4-door car with leather or cloth interiors in black, silver, or white. How many different combinations can be made with the car options?

Answer value

Answers

Answer: I think 12

Step-by-step explanation:     all the posibilitys-

1. 2 doors  

2. 4 doors

3. silver

4. black

5. white

6. cloth

7. leather

a camera listed price of $535.98 before tax. If the sales tax rate is 9.75%, find the total cost of the camera with sale tax included. Round your answer to the nearest cent, IF needed.

Answers

Answer:

The camera's final price will be $588.24.

Step-by-step explanation:

First you want to turn the percent into a decimal. 9.75%=.0975

Then, you want to multiply 535.98 by .0975.

You get $52.26 when you round to the nearest cent. The you add 52.26 to the original price and you get your answer!

Other Questions
why human are not responsible for global warming? Which of the following cells can generate ATP through glycolysis? A. Eukaryotic Cells (Plants and Animals) B. Prokaryotic Cells (Bacteria) C. None of the above D. All of the above What is the length of EF in the right triangle below? Choose one of the three themes (social oppression, greed, or good vs. Evil) and explain something you know about it in the real world OR explain where else you have seen the theme (a book, movie, show, etc.) Please help quick What is f(2) if f(x) = 2x-5 and f(4) if f(x) = -3x + 15step by step please! Solve.Okay here is 20 letters brainy Please which one is the right answer Please help with this What is public participation? Why is itnecessary for environmental conservation AUUUAACUGUUCUGUCUAGAG1. Construct an Explanation Based only on the information provided, why could themRNA section be translated into three different sets of amino acids, instead of just oneset?2. Use Models Use the genetic code to translate the sequence into each of the threepossible sets of amino acids.3. Draw Conclusions Which of the three sets of amino acids is the most likely to beincluded in the polypeptide? Explain your reasoning. Please help me with this homework Different cities have different sales tax rates. Here are the sales tax charges on the same items in two different cities.Complete the tables. 50 points brainliest I'm watching to wait explain the difference between essential body fat and storage body fat which is true about the subject matter of an ode?a. it is usually a well-known object such as a monumentb. it varies greatly from famous people to ordinary objectsc. it is often something imaginary or mythicald. it tends to focus on an explored exotic places Find the amount of sales tax if the sales tax rate is 5% and the cost of the winter coat is $40. Hint: this question is only asking for the sales tax. I dont get- this thing .-. b.10 ftC3 ftarea of the rectangle =area of the triangle = In "House of the Scorpion", why can't they harvest El Patron's body? (plz quickly help meh due tomorrow) Ill mark you a branilyst if you answer this question Two charged objects originally felt 12N of attraction. One charge is changed from to 3C to 6C and their distance changes from 15cm apart to 45cm apart. What is the new force of attraction ?