I need help to describe a time when someone didnt listen to me because of my age in an ESSAY!!!! CAN SOMEONE PLS HELP ME

Answers

Answer 1

think of a time when someone such as maybe you cousins or parents or someone didn't take your advice or they didn't listen to you.

If you need more help let me know

Answer 2

Answer:

Start with a topic. Are needing help with that?

Explanation:

Best thing to do is start off with your topic. Maybe think of a time when you felt disappointed or let down because a friend or someone close to you didnt listen to you. Maybe there was a time when you had a certain belief or thoughts on something particular and someone made you feel discouraged because of you age.. If so, Make that your topic to your essay. Also, best thing to do with type of essay a narrative, is to start with an Outline, simply start writing down all of your thoughts and things you want to include into your essay, this makes it much easier! Once you have done that. Then start typing up your essay. When your done with it, make sure to go back and revise it and edit it. I truly hope this helps you in some way! Good Luck.. should you need any more help or questions, let me know!


Related Questions

What are the continuing education information campaigns of the CHED and other institutions in solid waste management?​

Answers

Answer:

To create awareness among people about the management and harmful effects of these solid waste.

Explanation:

The educational information campaigns of the CHED and other institutions in solid waste management are provided in order to create awareness among people. These campaigns are created to inform people about the right way to manage solid wastes in the society and tell people the harmful effects of these solid waste. With the help of these campaign, people manages solid waste in a right in order to avoid diseases occur through them.

The continuing education information campaigns of CHED and other institutions in solid waste management are those that seek to influence actions and attitudes that promote environmental sustainability.

This type of CHED media has a positive impact on society by promoting the importance of solid waste management for environmental preservation.

Therefore, by instituting continuing education campaigns, CHED will assist in disseminating information on the effectiveness of solid waste management for sustainability and social awareness on this issue.

Learn more here:

https://brainly.com/question/23667629

Which statements best describe her paragraph? Select three options. Sentence 1 offers a logical reason that supports Beatriz's claim. Sentences 2–3 do not offer relevant evidence to support the main idea of the paragraph. Sentences 2–5 could be supported by relevant examples of Dylan's lyrics. Sentences 2–5 do not offer sufficient evidence to support the main idea of the paragraph. Sentence 6 introduces a new reason rather than evidence that supports the main idea of this paragraph.

Answers

Answer: A,C & E

Explanation:

edg

Answer:

a,c,e

Explanation:

Browsing animals in northern Russia eat mostly lichen, a short moss. What is northern Russia's vegetation region?

A. Highland
B. Tundra
C. Temperate grassland
D. Ice cap
Help

Answers

B tundra is the answer

the correct answer is B

Vegetation changes from north to south, and three subdivisions are recognized: Arctic tundra, with much bare ground and extensive areas of mosses and lichens; shrubby tundra, with mosses, lichens, herbaceous plants, dwarf Arctic birch, and shrub willow; and wooded tundra, with more extensive areas of stunted birch, ...

Which country is represented by the yellow dot

Answers

flag of Palau(The flag of Palau was adopted on 1 January 1981, when the island group separated from the United Nations Trust Territory)

Which of the following is usually true about abusive partners?

Answers

Answer:

You forgot to provide option choices.

What you’ve been doing during the past weekend? What were the major and minor things you did during weekends which you remember (in chronological order).

Answers

Answer:

LOL nothing

Explanation:

Anwser

Well the things I did daily was:
Clean the kitchen
Clean my room
Brush my teeth
Get dressed
Shower
Pray

106-07-004-SST
gro
amount of
ACTIVITY
RESULTS
Based on information in the Article, which of these happened after Dr. Ochoa logged nearly 1,000
hours in orbit?
physics (n
a science to
and energy
on each oth
electricity,
Hint
А
She watched as Dr. Sally Ride became the first American woman to go into space.
research
careful stud
and report
something
B
She worked as an engineer at NASA.
Extras
с
She received NASA's Distinguished Service Medal.
Puzzle
She gave a short concert, which turned into a funny physics lesson in a weightless
Citations
D
environment.
Rubric
Take Nc
Submit
As you read
Ochoa's stor
determinatio

Answers

Answer:

A,C,D

Explanation:

Because it just sounds like so much fun

Help pls? I rlly need it. Western Europe

Answers

Answer:

Ireland

Explanation:

Yeah it’s Ireland. At least I’m pretty sure

Closure is the process of
O A. filling in missing parts.
O B. interacting with our senses.
O C. finding proximity.
O D. finishing a sensation.

Answers

Answer:

A. filling in missing parts.

Explanation:

The question above is related to the subject, "Psychology." This is related to the "Law of Closure" of the Gestalt Law. This is an illusion that we create by filling in the missing parts whenever we see objects that are broken. So even if a circle has a missing part (incomplete stimulus), we tend to see it (unconsciously) as a whole or as a completely closed circle despite having gaps in between.

Answer:

filling in missing parts

Explanation:

Describe 2 types of age roles

Answers

Answer:

age is natural age cannot decrease but can increase age is limited

Explanation:

dont expect your age to be 200 or more

becuz thats bot possible

everyone has to die one day

u cant take money with u when u die so

give the money to me lolll

Which challenge does Canada face in its effort to reduce the use of fossil fuels?


A Fossil fuels are a large industry in the economy.


B There is no interest in developing other fuel sources.


C The cost of alternate fuel sources is too high.


D Manufacturers refuse to stop using fossil fuels.

Answers

Answer:

c

Explanation:

Answer:

. .

Explanation:

I can assure you that's the correct answer :)

Which of the following is NOT a reason people resist
change?
Select one:
a. Social inertia.
b. They have a vested interest in the status quo.
c. They accept the legitimacy of existing institutions,
O d. They are concerned that others will be angry with
them.

Answers

Answer:

i feel the answer is b i am not sure

Explanation:

The people do not resist change because they have a vested interest in the status quo. Thus, option B is correct.

What is status quo?

The term "status quo" refers to the current condition of events, particularly in social, political, religious, or military matters. The status quo in sociology refers to the existing condition of social organization and/or values.

The term "status quo" from Latin for "existing state." When we talk about the status quo, though, we frequently mean it negatively. People who desire to maintain the status quo are typically averse to change.

The status quo is the current state of events, especially in comparison to another hypothetical state of affairs. People do not oppose change because they have a vested stake in maintaining the status quo. As a result, option B is correct.

Learn more about status quo here:

https://brainly.com/question/15064402

#SPJ2

The Dead Sea is _____ times saltier than the world’s oceans.
A.
three
B.
six
C.
nine
D.
twelve

Answers

Answer: nine

Explanation: just learned this

Answer:

nine aka c

Explanation:

When coworkers need help, they ask Edwina. She seems to know more about the job than everyone. She graduated with high honors from college and continues to learn all she can about a variety of interests. Edwina would score high in ________. A. conscientiousness B. perception C. thinking D. openness to experience

Answers

Answer:

D. openness to experience

Explanation:

In this scenario, when coworkers need help, they ask Edwina. She seems to know more about the job than everyone. She graduated with high honors from college and continues to learn all she can about a variety of interests. Edwina would score high in openness to experience.

This ultimately implies that, Edwina is the type of individual who is always willing to develop her skills through the acquisition of work related experience. Thus, she has an open mind to becoming experienced at her career.

my picture please hahahahahahah​

Answers

What oh now I understand
Jk

Answer:

si BADANG

Explanation:

FIGHTER 32,000 bp para mabili

sa ML makikita ;-; sana nakatulong .-.

witch one of these is not apart of sociology
A. relationships
b. food chain
c.behaviors




ANSWER ASAP

Answers

Answer:

food chain

Explanation:

you do not sociolize in a food chain but you do in relationships and behaviors

HOPE THIS HELPS!!!! ;)

The food chain isn’t related to relationships and behaviors :)

Pyramids served which of the following functions in early Mesoamerican civilizations? O A. Courthouses O B. Centers of trade O C. Military fortresses OD. Religious temples​

Answers

D religious temples I think

The Johari Window is a model that describes the relationship between self-disclosure and ____________.

Answers

Answer:

The Johari Window is a model that describes the relationship between self-disclosure and self-awareness.

Explanation:

The Johari Window is a cognitive psychology model originally created by Joseph Luft and Harry Ingham with the aim of illustrating the processes of human interaction, analyzing the dynamics of personal relationships. It is a model that is often used in self-help groups to analyze the communication process and the perspective of personal relationships. It proposes two key points of view: the self and the others, that is, the internal point of view and the external point of view. This tool promotes self-awareness and self-disclosure, that is, it has the ability to help us better understand who we are, how we see ourselves and how we relate to others.

Help pls? Western Europe

Answers

Answer: Dairy products

Which of theses answers best describes a scientific theory

Answers

Answer:

where is the question

Explanation:

where is answer

The supply of ice cream in town has decreased. Which of the following circumstances most likely caused the reduction?
A. A new vendor opened in a neighborhood town.
B. The costs of milk and sugar decreased.
C. Several competitors shut down for the season.
D. Winter began, and snow fell for two weeks.

Answers

Answer: C

Explanation: because if the people who sold ice cream shut down then there would be no place to sell the ice cream at.

Lisa and Carrie live in two different countries. Both Lisa and Carrie regularly participate in local elections. Carrie is able to vote directly on issues that affect citizens. Lisa helps elect leaders who she believes will make decisions that are best for her country. Use the drop-down menus to complete the sentences. In both countries, decisions are made based on . Lisa most likely lives in a country with a democracy. Carrie most likely lives in a country with a(n) democracy

Answers

Answer:

answer, A,A,A

Explanation:

Answer:In both countries, decisions are made based on  

✔ the will of the people

.

Lisa most likely lives in a country with a  

✔ representative

democracy.

Carrie most likely lives in a country with a(n)  

✔ direct

democracy.

Explanation:

help
meeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeee

Answers

Answer:

Crystal Structure | Minerals

Fixed Chemical Composition | Minerals

Identified by Color and Texture | Rocks

Classified by Mode of Formation | Rocks

Explanation:

promise all due submission and obedience
How did this document contribute to the growth of constitutional government in the English colonies?

Answers

C Stated importance of forming new government

how do you predict 2 ways the Jamestown colonists died? Explain how you know

Answers

Answer:

by diseases of mosquitos and sickness like chicken pocks

Explanation:

bevause of mosquitos a lot of people died of malaria and for chicken pocks they didn't have a medicine for it and many people died for this.

how might have the oppressive British rule influenced the ideas of the articles of confederation ?​

Answers

Nationalism is when a country favors political independence over outside forces.

- - -

The answer is: The oppressive British rule influenced the ideas of the articles of confederation.

Answer:

The oppressive British rule influenced the ideas of the articles of confederation.

Explanation:

This relates to the Articles of Confederation because the articles make each state have protection and power making it equal not leaving one to rule. Making these laws formed independence from Great Britain forming a national government.  

Using prescribed wildfires can prevent natural wildfires from posing as great a risk to property owners

Answers

Answer:

True.

Explanation:

The given statement asserts a true claim regarding the use of recommended wildfires assisting in halting natural wildfires in distinction to producing a great threat to the property holders. These wildfires include recommended burns which assist in maintaining the controlled fire applications through a particular team of experts. It helps in preventing burning, reducing hazards, backfire, etc. Thus, the statement is true.

Answer:

True

Explanation:

It true edg

explain why committees and debate such an important part of the legislative process ?

Answers

Answer:

Committees are an essential part of the legislative process. ... Of all the measures sent to committees, only a small percentage are considered. By considering and reporting on a bill, committees help to set the Senate's agenda. When a committee or subcommittee decides to consider a measure, it usually takes four actions.

Explanation:

hope this helps

In the nineteenth century, European nations began seizing lands in the Middle East to

A-prevent war between Israel and Palestine

B- Take control of oil reserves

C- Stabilize the warring region

D- Spread Christianity

Answers

Answer:

B- Take control of oil reserves

Explanation:

Around 65% of the oil Reserves in the world are located in the middle east region. In the 19th century, the European industries started their transition from using coal as the main energy fuel into oil. This made a lot of them set their eyes to take control of the middle east region.

This interest is considered as the stem of conflict between the western nations and the middle east region even to this day,.

What should the memorial look like?

Answers

Answer:

Explanation:bend dhd d sh

Other Questions
five men build a wall in 10 days how long will it take 10 men Anchara drops a penny from a height of 60 feet above the ground. The equation h=-16t^2 + 60 models the penbys height h i feet as a function of time t in seconds whatvare the solutions P3- is a(n) ______________________, so it ________________ valence electrons. Group of answ er choices anion, gained cation, gained cation, lost anion, lost The following DNA is being replicated and the origin of replication is in the middle of the sequence and marked with three stars ***. 5'ATCGGGCTACCCATGAAATGCTAGCATT***TAAGATCTTAAGCTAGCTAGTTCGATCTGA3'What is the sequence of the primer for the LEADING strand? Your answer should be 8 nucleotides long, written from 5' to 3' and only include the nucleic acid sequence (ex: ACTACTAC).note: there are two answers for this question A farmer's market is selling peaches for $2.00 a pound. If you buy 2 pounds, you save 10% on each pound. How much does it cost to get 2 pounds of peaches? 1. What right do education encompasses both entitlements and freedom?A. Right to free and compulsory primary educationB. Right the quality education in private schoolC. Right to choose yourteachersD. All of the above2. Which of the following is an example of non-formal education?A. Primary schoolingB. Senior high schoolC. Adult night classesD. Doctorate program El libro. _____ Libros. Approximately how many people are likely trafficked into the United States each year?5,5008,5008,50011,50011,500-14,500O 14,50017,500 She dove 75 feet under the sea To be eligible for Bright Futures, you must submit a statement explaining how all money will be repaid submit a plan of action for all courses throughout college take at least three remedial credits in the first semester take at least six non-remedial credits per semesterplease only answer if you know what your talking aboutand if your right i will give brainiest. What was the biggest drawback of Chinese block printing? In a perfectly insulated container of negligible mass, 4.00 102 kg of steam at 100C and atmospheric pressure is added to 0.200 kg of water at 50.0C. A) If no heat is lost to the surroundings, what is the final temperature of the system? B) At the final temperature, how many kilograms are there of steam and how many of liquid water? What is the importance of the Battle of Khanua and Chaunsa? VocabularyMake a sentence using these two wordsdedicated, obstaclecollaborate, techniques 3) Complete the sentences. Use the Past Simple or the Present Perfect Simple form of the verbs in brackets1 Marry_____(win) the lottery last year.2 I _____(not see) anyone yet.(come/just) home.4. They____(buy) the car two years ago5. William still____(not buy) the present for his sister 4 Complete the sentences. Use the Present Perfect Simple or the Present Perfect Continuous form of the verbs inbracts1. The baby's face is really dirty. What____(he/eat)?2. Like____(never/be) abroad3. Eva is exhausted these days. She______(work) too hard recently.4.______(you/finish) your homework yet?5. I_____(clean) all morning I'm really tired! 6x = 10y - 10x + y + 7 = 0What is x and y? Kiran and Clare live 28 miles away from each other along a rail trail Kiran walks at a speed of 3 miles per hour while Clare walks 4 miles per hour how long will it take the two friends to meet Choose the correct conjugation of the verb DAR in the following sentence:Ustedes __________ comida por la noche.Group of answer choicesdamosdoydasdan Which of the following statements is true about covalent bonds?Valence Electrons are shared in order to achieve the bondO Covalent bonds form when the nuclei of atoms attract each otherO Covalent Bonds all have the same bond length no matter what atoms are in thebondTransferring of electrons from one atom to another creates the bond the first person with the correct answer will get the brainiest.Read the excerpt below by Walt Whitman.(Other lands have their vitality in a few, a class, but we have it in the bulk of our people.)Which statement best summarizes the excerpt?The wealthy upper class in other countries gives each nation its vitality.The powerful upper class in the United States gives the nation its vitality.The common people in other countries give each nation its vitality.The common people in the United States give the nation its vitality.