If you develop your sinews you will be?

A. fit and strong
B. wise beyond your years
C. wealthy and powerful
D. sympathetic to others

Answers

Answer 1

Answer:

A

Explanation:


Related Questions

heat is too dry as water vapor is to​

Answers

Heat is to dry as water vapor is to wet or moist.
Can be either of the two words depends on your grade levels expectations

What caused the English spoken today to be different from the English spoken in earlier centuries

Answers

English has gone through many phases. English was different in the earlier centuries because of the necessity. With all this new technology there has got to be new words being invented. English language went through natural selection. Some words, phrases and song stuck with us and others withered away.

Plz help ASAP thank you

Answers

Answer:

nle choppa

Explanation:

What are the Four Goods of the human nature that we all should consider and follow its desires?​

Answers

Answer:

The Four Goods of the human nature that we all should consider and follow its desires is explained below in detail.

Explanation:

The correct answer is to follow THE EIGHT FOLD PATH. There are four excellent truths in Buddhism about human nature:

1. everything in life is misery and sadness

2. the source of all suffering is people self-centered desires

3. the mean of controlling suffering is to end all desire

4. the way to succeed in all suffering is to follow the eightfold path.

When you make an inference, you:
A. debate whether there is merit to what the author writes.
B. ask critical questions about the text.
C. figure out what a new vocabulary word means and why the author
chose it.
D. find meaning in the text beyond the words that are written.

Answers

D A conclusion reached on the basis of evidence

Read the stanza from “The Charge of the Light Brigade” by Alfred, Lord Tennyson


“Forward, the Light Brigade!”
Was there a man dismayed?
Not though the soldier knew
Someone had blundered.
Theirs not to make reply,
Theirs not to reason why,
Theirs but to do and die.
Into the valley of Death
Rode the six hundred.

Where are the stressed syllables in each line, and what is their effect?


The first and fourth syllable in each line; it creates a sensation of horse hooves drumming on the ground.


The first syllable in each line; it slows the reader at the beginning of each line.


The last syllable in each line; it creates a pause at the end of the line.


Every other syllable in each line; it creates a sing-song rhythm.

Answers

Answer:

The first one that says the first and fourth syllable.

Explanation:

Just completed the test and that was the correct answer

The first and fourth syllable in each line; it creates a sensation of horse hooves drumming on the ground are the stressed syllables in each line, and “The Charge of the Light Brigade”. Thus, option (a) is correct.

What is the theme “The Charge of the Light Brigade”?

The famous English poem “The Charge of the Light Brigade” was the written by Alfred, Lord Tennyson. The poem was the main theme was the based on Conflict, Death and Duty, Courage. The main concept of the poem is the death of the solider.

“The Charge of the Light Brigade”, we emphasize one of the syllables of the word; this is known as "stressed syllables," and it is also known as the accented syllable. The stressed syllables in a poem or stanza aid the author in creating rhythm. The stressed syllables in the provided text are the first and fourth in each line. We can detect it by reciting it aloud and focusing on the accentuation.

As a result, the first and fourth syllable in each line; it creates a sensation of horse hooves drumming on the ground are the stressed syllables in each line, and what is their effect. Therefore, option (a) is correct.

Learn more about on “The Charge of the Light Brigade”, here:

https://brainly.com/question/1343588

#SPJ2

"i cheer for people. i was raised to believe there's enough sun for everyone " write 2 paragraphs of what you think why it has meaning to you, how it might be helpful or relevant to other's.​

Answers

Answer:

I am unsure on how to help you. I think you would need to do this on your own, since I am unable to know what it truly means for you. I wish you the best of luck, I hope you can manage to pull it off.

Why should masks be mandatory?

Pls answeerrre

Answers

Answer:

Because they are to help decrease the rate of people getting Carona.

Explanation:

hope this helps:)

Question 3 of 18
Which sentence most clearly describes a theme?
O A. Dialogue reveals the character's attitude.
O B. The heart is a common symbol for love.
O C. Harry Potter finally becomes a wizard.
O D. True friends are there during a crisis.

Answers

D. Is the the main theme.

The sentence that most clearly describes a theme is "True friends are there during a crisis".

What is a theme?

A theme is "the subject of a talk".

The sentence that most clearly describes a theme is "True friends are there during a crisis" because this sentence clearly talks about a subject that can be followed throughout the story and teaches the audience something valuable.

To learn more about theme here

https://brainly.com/question/20270652

#SPJ2

Who reappears while Percy, Annabeth, and Grover are on the bus? How do they escape?

Answers

Answer:

the math teacher and her sisters

Explanation:

Answer: Miss Dodds reappears and they escape by jumping off the bus.

Explanation:

If the Latin root fais means “to do,” what does feasible mean?

capable of being done

action of completing a task

willing to participate

unwilling to do

Answers

Answer:

I believe the answer is: capable of being done

Explanation:

capable of being done :)

you did not make a mistakes. (affirmative)​

Answers

???????????????????????

Answer:

you never made a mistake

6.
What is the meaning of "flippant" as it is used in paragraph 30?
A. benevolent
B. frivolous
C. callous
D. defiant

Answers

frivolous

hope this helps !!

Answer:

frivolous

Explanation:

Part A

Based on "'Equal Justice Under Law': Thurgood Marshall," what can the reader infer about how segregation affected the self-image of African American children?


Segregation only occurred in the South, so it had little effect on most African American children.

It was damaging because they were wrongly convinced that it was preferable to be white.

It was dangerous because it caused negative feelings toward themselves and others.

Children of different races played together outside of school, which boosted self-image.
Question 2
Part B

What evidence from the text best supports the answer in Part A?


"Anything from a water fountain to a movie theater or public park might have a sign saying 'Whites Only.'"

"The children said the white dolls were 'nice' and 'pretty.' The brown dolls, they said, were 'ugly' and 'dirty.'"

"He showed each child two white dolls and two brown dolls. Then he asked which dolls they liked best."

"The facilities for black Americans, the Court said, simply had to be as good as those for whites—'separate but equal.'"

Answers

Answer:part one is NOT B

part two is C.

Explanation:

Answer:

The correct answers are D and C

Explanation:

took k12 test

Read the exert:
Each night, thousands of residents in New York City are cleaning and putting out fresh towels. They are preparing to rent their apartments to strangers. Residents are using Web sites such as Airbnb.com. There, they can list apartments or rooms by the night. People who rent out their homes say it helps them. It is often the only way they can afford to pay their rent. Rents are about $3,000 a month, but can be $6,000 in some areas. New York is the nation's most expensive city. Mishelle Farer has a two-bedroom apartment. She rents the second bedroom. She says she earns about half her rent this way.

the expenses are_______.
A.dismissed
B.shared
C.sorted
D.charged

Answers

Answer:

C.

Explanation:

It would be C because it is sorted in some areas.

Not so good with explanations. . .

ayudenme porfavor

Fill in the blanks using “HE, SHE, IT, WE, THEY”:


cat and horse……THEY…… Mary…she Tom ……he

Jack and I ………….. books …………. sister ………….

You and Dave ……….. plane …………. sunshine ……….

cheese ……………… cactus ………… parents …………..

Pamela ……………… news ................ scissors ...................

geese ……………. flowers ………… piano …………….

school …………. daughter ………… milk ……………

children ……….. sugar ……….. feet …………..

bicycle ………… Ann and Kate ………. tennis ………….

son ……………. mice …………… sky …………….

shop ……………. buses ………….. papers …………

Mr. Green …………… brother-in-law ………….. picture ………..

friendship …………. dolphin ………… The Riggs family ………..

Answers

Jack and I - we
Books - it
Sister - she
You and Dave - they
Plane - it
Sunshine - it
Cheese - it
Cactus - it
Parents - they
Pamela - she
News - it
Scissors - they
Geese - they
Flowers - they
Piano - it
School - it
Daughter - she
Milk - it
Children - they
Sugar - it
Feet - they
Bicycle - it
Ann and Kate - they
Tennis - it
Son - he
Mice - they
Sky - it
Shop - it
Buses - they
Papers - they
Mr. Green - he
Brother-in-law - he
Picture - it
Friendship - it
Dolphin - it
The Ringgs family - they

Can somebody plsssss help me with making a reading song that’s about reading it has to be at least 1 minute and 30 seconds long she said and the song can’t be corny giving away 20 points

Answers

You could probably add “ you use reading everyday” but I’m not good at songs

Hope this helps

Have a great day/night

A student plans to use the details in this passage as part of a research
paper. What additional information is needed to properly credit the
passage in the list of sources used?
A) full publication information
B)
the number of pages in the book
C) the name of the original source
D) the birth and death dates of Frederick Douglass

Answers

The answer is C the name of original sources.

Answer:

A: Full publication information

Explanation:

hope it helped

When a count appointed Till Eulenspiegel as a watchman, Eulensplegel was dejected. He wanted to be a knight. While the knights feasted,
Eulenspiegel was left to watch the castle for an enemy. Fed up with the life of a watchman, when an enemy came, Eulensplegel did not sound
the alarm. When the count found out, he defeated the enemy and sent Eulenspiegel back to the watchman's tower without food, while the rest
of the knights feasted. How did Eulensplegel get the food that the knights feasted upon?
O A Eulensplegel went to the count and convinced him to make him (Eulenspiegel) a knight.
O B. Eulenspiegel tricked the knights out of their food, after winning a game of cards against a knight.
OC. Eulensplegel convinced the count to give him some food from the food that the knights were eating,
OD. Eulenspiegel raised the alarm for an imaginary enemy and while the knights were searching, he ate their food.

Answers

Answer:

The answer is D) Eulenspiegel raised the alarm for an imaginary enemy and while the knights were searching, he ate their food.

Explanation:

Answer:

For plato family

Explanation:

D . Eulenspiegel raised the alarm for an imaginary enemy and while the knights were searching, he ate their food.

Explanation:

I just  took the test

When What is your lowest or down moment experiences​

Answers

My lowest moment was probably when I realized i wouldn’t have a father. It was hard initially, but now i’m alright and know i don’t need him.

felt terrible

Answer:

Hey Queen Messy here!

ow moments exists. More or less frequently they’re coming in each one’s life. Sometimes they’re suddenly bursting in on our lives and we just cannot hide as much as we might trying.

We hate them and want them quickly out of our path.

Though, pretending they aren’t there isn’t a solution. Because they might go away for the moment and then come back stronger.

Better let your low moments talk to you and listen carefully.

Explanation:

hmmm sorry for not giving a proper answer :(

PLS HELP I WILL MARK BRAINLIEST!! Exit Slip: Previously, in the argument of which mascot would make a better pet, a cat or a dog, you chose a position and supported it with 3 claims as to why. Now, provide a counterclaim that addresses the opposing viewpoint and then maintain your position with your best rebuttal.

Answers

Answer:

Dogs Are Better

Explanation:

Dog would make a better mascot because there more energetic more fun and adorable cats mostly aren't athletic and cats mostly lay all day while dogs run play cats can be a mascot but dogs would be a better mascot.

Which form of narration is more effective? the tell tale heart or the monkeys paw

Answers

Heart is important more affective

Picturing a lush location within a rain forest to remember what types of plants grow there is a form of categorization.
Please select the best answer from the choices provided
T or F

Answers

Answer:

F

Explanation:

edge 2020

Answer:

False well i think sorry if i get it wrong

Explanation:

Please help me ASAP I’ll mark Brainly

Answers

he’s allergic to cats


How do you think faith or hope could help us be more resilient?

Answers

Answer:

Because Resilient is like a comeback from something horrible that happened to you. So faith and hope would help us be more resilient by having faith and hope meaning you have faith of hope that something will change if your in a bad situation. For example Alot of people that are either sick of homeless have hope and faith that someday that will all change and they will eventually live a better life.

Explanation:

Hope this helps you :)

answer pls ill give brainliest

Answers

Answer: The third one

Explanation:

Answer:

C                                                              

bbdbbdbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbb

Answer correctly pls

Answers

Answer:

C

Explanation:

Answer:

C

Explanation:

ccccccccccccccccccccccccccccccccccccccccccccccccccccccc

Any writing that reads the same forward or backward is a. IM IN QUIZ PLS GET IT ASAP!!!


A. Palindrome
B. Limerick
C. Pun
D. Conundrum

Answers

Answer:

A. Palindrome

Palindrome which is A is the correct answer .

PLEASE HELP ME PLEASE

Answers

Answer: Basically a summary of what you just read and talk about what he did

Explanation:

let's say you hypothetically ran over someone with your car, and they are now under your car in between the front wheels and the back wheels, right, and they're stuck as in can't breathe type stuck, right, do you keep driving so they can breathe or do you let them chill under your car?
just curious...​​

Answers

lol just eat him come on

Answer:

If you keep dragging them then you are most likely going to kill them and they will die slowly and very painfully.

Law&Order SVU Season 7  Episode 22

I hope this helps:

Other Questions
BackgroundLayout-ThemeTestos2Freda bought 6 gallons of gasoline for $19.14What was the unit price of this gasoline? Read the quotation below from a high school science student.We used a formal method of study to figure out which kindof grocery bag had the least effect on the environment.What is the student describing?O A. Using scientific toolsB. Making random discoveriesC. Using the scientific methodD. Making a conclusion 3(5 + 6)=....................... A businessman wants to buy a truck. The dealer offers to sell the truck for either $120,000 now, or six yearly payments of $25,000.What is the interest rate being offered by the dealer in percentage (rounded to the closest integer number) 30 POINTS HELP Which idea was supported by Aristarchus, Copernicus, and Galileo?The planets have epicycles.The planets revolve around the Sun. The stars rotate around the Sun.The center of the solar system is Earth. The belief that Europeans are the superior class in society is called? Question 1 of 11What are two ways space exploration can improve international relations?DA By urging countries to compete to achieve goalsDB. By helping countries' economies grow weakerDC. By encouraging countries to share scientific dataDD. By inspiring countries to work together to solve problems explain the ides behind majority rule and minority rights 3. Study the changes in population graph, what % lived in cities by the 1930's?By the 1970's? What led the people of France to agree to an imperial dictatorship instead of a true democratic republic like the one selected in the American colonies? why human are not responsible for global warming? Which of the following cells can generate ATP through glycolysis? A. Eukaryotic Cells (Plants and Animals) B. Prokaryotic Cells (Bacteria) C. None of the above D. All of the above What is the length of EF in the right triangle below? Choose one of the three themes (social oppression, greed, or good vs. Evil) and explain something you know about it in the real world OR explain where else you have seen the theme (a book, movie, show, etc.) Please help quick What is f(2) if f(x) = 2x-5 and f(4) if f(x) = -3x + 15step by step please! Solve.Okay here is 20 letters brainy Please which one is the right answer Please help with this What is public participation? Why is itnecessary for environmental conservation AUUUAACUGUUCUGUCUAGAG1. Construct an Explanation Based only on the information provided, why could themRNA section be translated into three different sets of amino acids, instead of just oneset?2. Use Models Use the genetic code to translate the sequence into each of the threepossible sets of amino acids.3. Draw Conclusions Which of the three sets of amino acids is the most likely to beincluded in the polypeptide? Explain your reasoning.