*****!!!! lots of points and brainliest!!!******** how do i find the codon and anti codon? :)
Answers
Answer:
The way to find a codon is by arranging the sequence of nitrogenous bases of the mRNA in groups of three, the triplets. Once the codon is found, the anticodon corresponds to a complementary triplet to that codon.
Explanation:
Codon corresponds to a triplet of mRNA nitrogen bases encoding an amino acid. Anticodon is responsible for carrying amino acids to the ribosome, according to the information of the mRNA, and the sequence of its triple must be complementary to that of the codon mRNA.
If, for example, a codon of the mRNA is AUG, its anticodon of the tRNA must be UAC, that is, complementary. Then, for the indicated exercises:
Exercise 1:
DNA ATACGAAATCGCGATCGCGGCGATTCGG mRNA UAUGCUUUAGCGCUAGCGCCGCUAAGCC CODON UAU|GCU|UUA|GCG|CUA|GCG|CCG|CUA|AGC|C- AntiCODON AUA|CGA|AAU|CGC|GAU|CGC|GGC|GAU|UCG|G- Amino acid Tyr|Ala|Leu|Ala|Leu|Ala|Pro|Leu|SerExercise 2:
DNA TTTACGGCCATCAGGCAATACTGG mRNA AAAUGCCGGUAGUCCGUUAUGACC CODON AAA|UGC|CGG|UAG|UCC|GUU|AUG|ACC AntiCODON UUU|ACG|GCC|AUC|AGG|CAA|UAC|UGG Amino acid Lys|Cys|Arg|Stop|Ser|Val|Met|ThrRelated Questions
Yeasts reproduce by budding. During budding, a yeast cell splits into two cells. Then the two cells split, making four cells. Determine how many yeast cells would result from 5 buddings.
Show your work.
Answers
Answer:
20 yeast cells would be formed.
Explanation:
You have five cells. Each of those five cells split into two, so now we have 10 cells. Think about it like multiplication, so 5 times 2 = 10. Now we have 10 cells. We know that they split even further, so now those 10 cells become 20 cells. Here is a more simple explanation:
5 cells:
* * * * *
Now those five cells split up into 2:
* * * * *
* * * * * * * * * *
Then those new ten cells split into four:
* * * * *
* * * * * * * * * *
* * * * * * * * * * * * * * * * * * * *
Add 4+4+4+4+4 = 20 or 4 times 5 which would also equal 20.
And that is the answer, hope that helped :)
4. What is the name of the membrane in blood cells that allows for certain
substances to pass through it, but not others? *
Cell wall.
Semipermeable membrane.
Cell membrane.
plasma membrane
Answers
Answer:
It is Plasma Membranes.
Answer: Plasma membrane
Explanation:
Can I be Brainliest bc i was first
n
How does water heat Earth?
Water traps heat and holds it deep inside the ocean.
Water transports nutrients and waste.
Water carries heat from the equator toward the poles.
Water from rainfall on land starts in the ocean.
Answers
Answer:
Water transport nutrients and waste
Answer:
water transport nutrients and waste i think
Explanation:
i think its right
Which of the following is true of pine rockland habitats?
Answers
Answer:
Dry habitat.
Explanation:
Pine rockland has a dry habitat due to their location on higher ground. Pine Rocklands, also known as the Pinelands which have a hard rocky ground, made up of limestone. Pine rockland is an endangered habitat because 98 percent of the original habitat is lost while only 2 percent is remaining. This is due to the increase in population so the human clears the area for building places.
Answe me if you can, thank you
Answers
Chloroplasts are found in Eukaryotic Autotrophs i.e. those who can make their own food with the help of sunlight using carbon dioxide and water. Eukaryotes are Eukaryotes are organisms whose cells have a nucleus enclosed within a nuclear envelope.
_____________________________________Example:The Example of Eukaryotic Autotrophs are Plants and Algae. They are the producers in the food chain also the main source of the oxygen, as they use Carbon Dioxide for a glucose's carbon structure and releases oxygen as By-Product.
_____________________________________Why are they green?Chloroplasts get their green color by the presence of chlorophyll, which is the main site for the process of photosynthesis. It is a green photosynthetic pigment found in plants, algae, and cyanobacteria. Chlorophyll absorbs mostly in the blue and all the other colors to the lesser extent while reflecting green. They are present in leaves, and as the chlorophyll reflect green color, Thus the leaves look green to us.
_____________________________________Best Regards,'Borz'Which is it?? DNA, RNA, or Both??
1. Single-Stranded
2. Double-Stranded
3. Nitrogen bases
4. Thymine
5. Uracil
6. Double Helix
Answers
2. DNA is double stranded
3. Nitrogenous bases can be found in both RNA and DNA.
4. Thymine is found in DNA
5. Uracil is found in RNA
6. DNA has a double helix structure
what is reproduction
Answers
Answer:
1st definition the process of duplicating something.
2nd definition The process by which an organism produces its offspring is called reproduction.
Answer:
To make a copy or to duplicate something
Explanation:
Hope this helps!
JM0206
aka old account
Jade0206
Which type of mutation results in a frameshift
mutation?
substitution
insertion
deletion
point mutation
Answers
Answer:
Insertion and deletion result in a frameshift mutation. Frameshift mutations caused by "indel" mutations, meaning insertion or deletion mutations. These mutations shift the way the DNA is read. A frameshift mutation can throw off all of the nucleotide that follow in a DNA sequence, making them particularly likely to lead to significant consequences.
Root systems are classified as fibrous root systems and taproot systems.
Which property distinguishes the two types of root systems from each other?
A)
the method of water absorption
B)
the branching pattern of the roots
C)
the presence of xylem and phloem
D)
the growth rate of the roots
Answers
Answer:
B) the branching pattern of the roots
Explanation:
Plant roots function as anchors, food storage and aid in the uptake of water and minerals- other modifications include gas exchange and chemical signaling.
Root systems are mainly classified as taproots, usually found in dicots or fibrous roots found in monocots - some plants are a varying combination of the two systems. While tap roots consist of a larger, vertical main root surrounded by smaller lateral roots, fibrous roots are typically a dense network of roots that grow near the surface of the soil.
Taproots are thought to be more common in plants inhabiting regions experiencing water scarcity, while fibrous roots are thought to grow in more lush, water-abundant regions.
Examples of these roots systems include...
taproots: dandelions, carrots, turnipsfibrous roots: grasses, cornwhat protein is faulty in sickle cell anemia?
Answers
Answer:
Mutations in the HBB gene cause sickle cell disease. The HBB gene provides instructions for making one part of hemoglobin. Hemoglobin consists of four protein subunits, typically, two subunits called alpha-globin and two subunits called beta-globin.
Explanation:
Answer:
Mutations in the HBB gene cause sickle cell disease. The HBB gene provides instructions for making one part of hemoglobin. Hemoglobin consists of four protein subunits, typically, two subunits called alpha-globin and two subunits called beta-globin.
Explanation:
At 1:00 a.m., someone breaks a window in the back of a store and robs the safe. On the way out, the thief cuts himself (or herself) on a piece of the broken glass. You are a forensic detective called to the scene. You test the sample of blood left behind by the thief. It is O-. While you are there, police bring in a suspect with a cut in the forearm who was arrested just three blocks from the store. You take a sample of the suspect’s blood and mix it with anti-A. You immediately know that the suspect is not the person who cut himself on the broken glass in the store. How do you know this?
2. Suppose the same suspect's blood does not agglutinate when tested with anti-A or anti-B, but does agglutinate when tested with anti-Rh. Would this connect the suspect with the crime scene? Explain
3. Tom and Jane participate in a Red Cross blood drive. Both are first-time donors. As part of the screening.
A. What ABO antibody is found in Tom's blood?
B. What ABO antigens are found in Janes blood?
4. The same Tom and Jane's blood donations are sent to a processing center where the blood cells from the plasma in each of the two samples. The separated cells and plasmas are then sent to a hospital. A blood researcher wishes to use Tom's blood in an attempt to extract and identify the A antigen. Should she attempt the extraction process on his blood cells or on his plasma?
Answers
Answer:
Explanation:
When a blood group matches with an antibody it agglutinate this indicate an agreement furthermore when they do not agglutinate it denotes they aint compatible.
The suspect's whose blood is unknown on mixing with anti-A blood agglutinate and is immediately ruled out this is because the criminal who is 0- should agglutinate with anti-B.
When the suspect blood agglutinate on testing with anti-Rh it indicates that the suspect is O+ and not O-
Plasma are mostly filled with water blood samples should be extracted from blood cell.
A blood test is done by using chemicals that coagulate with the blood sample if it is positive for the test.
1. The suspect was not the same person was determined by using the blood test.
When the sample from the suspect is taken and mixed with the Anti A it would have got coagulated.For a blood sample to be O⁻ it should not agglutinate with either Anti A or B antibodies as the blood group O does not contain any antigen on its cell surface.2. If the blood sample does not agglutinate for both the Anti A and Anti B antibodies it indicates the blood type to be O.
But if agglutinates with the anti-Rh that means that it is an O⁺ blood group and not O⁻. Therefore, it cannot be connected with the crime scene.3. A. Tom's blood group is A+ the ABO antibody can be determined by:
According to the ABO blood group system, two types of antibodies are present antibody A and B in the plasma while two types of antigens anti - A and B are found in the blood cells. Tom have blood group A+ that means that he has antigen A in his RBC while antibody B is in his plasma. Therefore, Tom has antibody B in his blood as he is A+.B. Jane's blood group is AB+ which means that Jane has both the antigen A and B in her blood cells while there are no antibodies in her plasma.
4. The process of the extraction of antigen A from Tom's sample should be done from the blood cells as RBC contains the antigen while plasma is of no use because they contain the antibodies.
To learn more about the blood group systems follow the link:
https://brainly.com/question/15177700
How do the structures of the paramecium help it survive? Give specific examples.
Answers
What structure is the least complex
Answers
Answer:
In order, from least complex to most complex:
cells.
tissues.
organs.
organ systems.
organism.
Explanation:
A 60kg person climbs stairs of total height of 20m in two minutes.calculate the power delivered.g:10ms
Answers
Can cells leave g0?
A. Yes
B. Very rarely, but yes when there is a injury on a certain cell
C. No
please help I need the help:)
Answers
what causes a seismic waves
Answers
Answer:
Seismic waves are the waves of energy caused by the sudden breaking of rock within the earth or an explosion. They are the energy that travels through the earth and is recorded on seismographs. Earthquakes radiate seismic energy as both body and surface waves.
Explanation:
Answer:
caused by the sudden breaking of rock within the earth of an explosion.
Explanation:
dont judge me if im wrong
Cells in the body that can divide repeatedly and become other types of
cells are called *
O stem cells
O embryo cells
connective cells
O reproductive cells
Answers
Stem cells provide new cells for the body as it grows, and replace specialised cells that are damaged or lost. They have two unique properties that enable them to do this: They can divide over and over again to produce new cells. As they divide, they can change into the other types of cell that make up the body.
[tex]▪▪▪▪▪▪▪▪▪▪▪▪▪ {\huge\mathfrak{Answer}}▪▪▪▪▪▪▪▪▪▪▪▪▪▪[/tex]
The Correct choice is :
Stem cellsdiscuss the importance of amino acid to proteins
Answers
Placing the egg in which fluid would give a different result?
Answers
Answer:
Orange juice and vinegar both contain acids which react with the calcium carbonate in the eggs to produce carbon dioxide gas. This is why the eggs fizz in those liquids. Over time, this reaction has the effect of destroying the egg shells and leaving behind the inside of the egg.
Explanation:
Reyna pushed a box with 58 N of force, causing it to accelerate 5.1 m/s2. What is the
mass (in kg) of the box?
Answers
Answer:
m = 11.37 kg
Explanation:
F = m*a --> m = F/a = 58/5.1 = 11.37 kg
All organisms must have water for survival. If a drought causes the water in an ecosystem to become scares the organisms in this
ecosystem will not have as much water accessible to them
A decrease in the water available to an organism for cellular processes will most likely result in
CA
a decrease in optimal temperature ranges
e.
an increase in activity level
C, a decrease in metabolic activity
an increase in metabolic activity
Answers
Answer:
C, a decrease in metabolic activity
Explanation:
Water is an essential compound needed for the survival of all organisms in nature.
The bulk of most organisms is made up of water. Most importantly, water is integral part of cellular metabolic processes.
In the time of drought, metabolic activities will reduce. Organisms will tend to be inactive so as to conserve the little water they might have access to. This is an important adaption for organisms.
Is this right??? 2. Select all that are Halogens
beryllium
Carbon
Chlorine
Sulfur
lodine
Copper
Krypton
Answers
Answer:
chlorine, iodineExplanation:
halogens are those belonging to 17th group in a modern periodic table....
Why do you think scientists further classified vertebrates into smaller categories
Answers
A marathon runner completed a race of 26.2 miles in 3 hours and 15 minutes. What was his average speed throughout the race?
a) 7.5
b) 8.1
c) 8.7
d) 10
Answers
Answer:
b
Explanation:
The average speed of an object is the sum of the distance traveled by the object relative to the total time taken to cover the distance. In other words,
Average speed = total distance traveled/total time taken
In this case, the total distance traveled by the runner = 26.2 miles while the total time taken = 3 hours and 15 minutes
60 minutes = 1 hour
15 minutes = 0.25 hours, hence
3 hours 15 minutes = 3.25 hours
Average speed = 26.2/3.25
= 8.0615 miles/hour
= 8.1 miles/hour
The correct option is b.
15. The predator -prey relationship is a common type of A. commensalisms. B. animal interaction .C. plant interaction.D. mutualism .
Answers
Answer:
B. animal interaction
Explanation:
Answer:
Animal interaction
Explanation:
balls
asteroid, meteorite, craton, Canadian shield, differentiation, microcontinent, Precambrian shield, banded-iron formation, stromatolite, Ediacaran Biota
1)fossils of various multicellular organisms from about 630 Mya
2)the top of a craton exposed at Earth's surface
3)Metallic or silica rich object that bombard early Earth, generating heat energy
4)a small fragment of an orbiting body that has fallen to Earth; generating heat; does not completely burn up in Earth's atmosphere and strikes Earth's surface; sometimes causing an impact crater
5)a small fragment of granite rich crust formed during the Archean
6)name given to the Precambrian shield in North America because much of it is exposed in Canada
7)Alternating bands of iron oxide and chart; and cherty; an iron-poor sediment rock
8)continental core formed from Archean or Proterozoic microcontinents; deepest and most stable part of a continent
9)process in which a planet becomes internally zoned, with the heavy materials inking toward the center and the lighter materials accumulating near its surface
10)large mat of mound composed of billions of photosynthesizing cyanobacteria that dominated shallow oceans during the Proterozonic
Answers
Answer:
what's your question? I can help If I know what your looking for
FUN FACT OF THE DAY (day:4)
A baby fox is called a kit
A baby alligator is called a hatchling
A baby armadillo is called a pup
A baby fish is called a fry or fingerling
Answers
Answer:
lol wow
Explanation:
A baby alligator is called a hatchling
Can someone help with this pls (8th grade science)
Answers
Answer:
B to C
Explanation:
acceleration mean speeding up so that means it is B to C because that line is going down not up.
Explanation:
Its b because it's going down not up
Which of the following is the best evidence to support the belief that air is matter?
A you can't see air
B you can feel air blown from a fan
с air weighs nothing and has no mass
D air is what we breathe
Answers
Answer:
Explanation:Its C
We can feel air blowing from a fan because air is matter. It has its volume and mass. Thus, option B is correct.
What is the matter?Something that has volume and mass is called matter, which occupies space and can be weighed. The matter is affected by gravity due to its mass. There are generally three states of matter and that are solid, liquid, and gas. Everything you can see is matter. It is made up of very fine particles and we can not see these particles by the eye.
Even if air can not be seen but it has a volume and it can be weighed. When we blow a balloon, air goes inside the balloon, and its size increases because air has, it takes up space and we can weigh the balloon.
We can feel wind because air is matter. Therefore, the correct option is B.
Learn more about the matter, here:
https://brainly.com/question/13288978
#SPJ5
A group of scientists recently proposed the idea that beets should replace salt for melting winter ice. The scientists pointed out that because beets grow underground, they continue to grow in freezing conditions. Thus, they hypothesized, an extract of beet roots could melt ice on roads in winter. Make a prediction.
Answers
Answer:
Extract of beet roots has the capacity to melt ice
Explanation:
A prediction in research is a tentative statement that can be proven or disproven using an experiment. Predictions are otherwise referred to as hypotheses.
In the illustration, the prediction would be that the extract of beet roots has the ability to melt ice. After the experiment, the prediction would either be proven right or otherwise.