Movement of sugar into the cell is an example of _____

Answers

Answer 1

Answer:

The answer is Diffusion.

Explanation:

Diffusion is a net movement of molecules or ions where it moves from a region of high concentration to a region of low concentration.

In this case, cell has a lower concentration than sugar solution.


Related Questions

Global climate has changed in the past due to 1. __ and 2. __

1- air pollution
Earthquakes
Or plate tectonics

2- milankovitch cycles
Lunar phases
Or global warming

Answers

Answer: I think its air pollution and Global warming

Explanation:

Answer:

The answer is actually 1. plate tectonics and 2. Milankovitch cycles.

Explanation:

I got this correct on odyssey

what is meant by locomotor skill​

Answers

Answer:

Body moving from one place to another in a vertical plane. Develop bodily control. Walking, running, leaping, jumping, hopping, galloping, sliding, & skipping.

Explanation:

locomotor skills are skills that help your body move from one place to another. for example walking is a locomotor skill or jumping,skipping, running, etc

in which direction will air currents most likely move
A. from the land to the sea
B. straight up above the sea
C. from the sea to the land
D. straight down over the land ​

Answers

d from the sea to the land

Help me with this

A . Name the separation technique that can be used to separate lighter particles and heavier particles. Explain the principle behind this separation method

Answers

Answer:

Purification techniques

Answer:

It is just the techniques purification

Explanation:

two features of indirect democracy​

Answers

Answer:

trump

Explanation:

Define concentration gradient.

Answers

Answer:

A concentration gradient occurs when the concentration of particles is higher in one area than another. In passive transport, particles will diffuse down a concentration gradient, from areas of higher concentration to areas of lower concentration, until they are evenly spaced.

If Jamal does not sleep for four days straight, he will most likely experience __(blank)__. a) jet lag
b) psychopathic behavior
c) hallucinations
d) REM

Answers

c) hallucinations dkdjdjdjjdjd

Answer:

b? ig I mean u could experiance all, but this is an 8th grader talking what do i know?

Explanation:

what are bony platelet?

Answers

Answer:

a minute colorless anucleate disklike body of mammalian blood that is derived from fragments of megakaryocyte cytoplasm, that is released from the bone marrow into the blood, and that assists in blood clotting by adhering to other platelets and to damaged epithelium — called also blood platelet, thrombocyte.

Similarly, you may ask, what is the medical term for platelets?

The medical term for having too many platelets is thrombocytosis, and there are two types: Primary or essential thrombocytosis – Abnormal cells in the bone marrow cause an increase in platelets, but the reason is unknown.

What is the medical name for platelets?

Platelet: An irregular, disc-shaped element in the blood that assists in blood clotting. During normal blood clotting, the platelets clump together (aggregate). Although platelets are often classed as blood cells, they are actually fragments of large bone marrow cells called megakaryocytes

Explanation:

Platelets are fragments of megakaryocytes, which are very large cells in the bone marrow. They aid in the formation of blood clots, which slow or stop bleeding and aid in the healing of wounds.

What is blood clotting?

When a blood vessel is injured, blood clotting, or coagulation, is an important process that prevents excessive bleeding.

Platelets (a type of blood cell) and proteins in plasma (the liquid component of blood) collaborate to stop the bleeding by forming a clot over the injury.

Red bone marrow is responsible for the production of blood cells (hematopoiesis). Stem cells in your red bone marrow (hematopoietic stem cells) produce red, white, and platelets, which are all components of your whole blood.

Platelets are fragments of megakaryocytes, which are very large bone marrow cells. They promote the formation of blood clots, which slow or stop bleeding and aid in wound healing.

Thus, these are the main functions of platelets.

For more details regarding blood clotting, visit:

https://brainly.com/question/11230651

#SPJ2

Most of our dreams are about __(blank)__.
a) every day things and problems
b) childhood experiences
c) strange and unusual objects
d) repressed memories

Answers

It could be any of them some people have different feelings and emotions but if all of the above isn’t available I would go D

What happens to the amount of free water when you add salt to water

Answers

Answer:

it mixes i think lol

Explanation:

Ricin is a chemical that has the effect of blocking eukaryotic ribosomes from performing translation. Why is this a dangerous chemical?

Answers

Answer:

if the ribosomes can’t perform translation, the human won’t be able to perform synthesis. this will kill the eukaryotic organism.

Explanation:

Cookware companies have been using a chemical called C-8, which helps to create a nonstick coating to pans. However, the Environmental Protection Agency (EPA) recently claimed that the use of C-8 in the manufacturing of nonstick cookware should be discontinued because studies show it causes cancer.

Who might benefit financially the most from the EPA’s claim?

Answers

Answer:

Explanation:

The choices provided are:

a.restaurants that use C-8-coated cookware

b.cookware manufacturers who make pans out of steel only

c.stores that sell C-8 nonstick cookware

d.individuals who use steel cookware at home

From these choices B is the correct answer.

Restaurants that use C-8 cookware will not profit from using it but will need to lose money by replacing the old C-8 coated cookware.

Stores that sell this nonstick cookware will also need to replace their inventory so they won't be making extra money, only losing it.

And individuals at home will still be using steel cookware and won't benefit or lose anything by this change with the regulations of the c-8 coated nonstick cookware.

Sally conducts an experiment measuring plant growth. She finds that after two weeks, a plant that receives water grew 4 cm, but the plant that received soda died. What is the term for what is being measured?

Answers

Answer:

The correct answer is - the dependent variable.

Explanation:

In any study or research, the variable is that measured or affected by the change occurs lace in an experiment is called the dependent variable. The dependent variable depends on the factors or the variables that are changed in the experiment.

In this particular study, the variable which is measure is the height or growth of the plant which depends on the change in the hydrating supply so the dependent variable will be - the growth of the plant.

-Salicylic acid is a naturally occurring chemical produced in willow trees.
Salicylic acid is used by humans in some acne products to kill bacteria that
cause skin irritation
Based on this information, what stimulus most likely causes willow trees to
increase the production of salicylic acid?
Freezing conditions that damages leaves
Changing seasons with less direct sunlight
Damage to the bark of the tree trunk
Exposure to pathogens in the vascular tissue

Answers

Answer:   D on eduphoria

Explanation:

Recovering Ecosystems Worksheet Section 1: Select the Kitakami River region, the Abukuma Highlands, or Japan's coastal habitat as the ecosystem you want to help with recovery. List the main problem faced by this ecosystem as described in the lesson. Then list at least two sub-problems that need to be considered to solve the main problem. List the sub-problems in order of most to least important. In the rationale column, explain why you placed your sub-problems in the order you selected. Main Problem Sub-Problems Rationale Section 2: Conduct internet research on your selected ecosystem to help you generate a list of three criteria and two constraints. Your criteria and constraints should consider relevant factors to the problem, such as costs, reliability, safety (to humans and wildlife), human needs, environmental impact, local biodiversity, and the aesthetics of the area. List the criteria in order of most to least important and assign each to a related sub-problem. In the rationale column, explain why you placed your criteria in the order you selected. Constraints Criteria Rationale Which Sub-Problems does this criteria address? Section 3: For at least one of the sub-problems, propose two solutions based on the information from the lesson and your additional research. In the rationale column, explain how your solution restores the stability and biodiversity of your selected ecosystem. Sub-Problem Proposed Solutions Rationale Section 4: Answer the following analysis questions about your proposed solutions. Describe the ways your proposed solutions decrease the negative effects of habitat destruction and human activity on your selected ecosystem. Describe the costs, safety, and reliability of your proposed solutions, as well as any social, cultural, and environmental impacts your solutions address. Evaluate your proposed solutions for their impact on overall environmental stability and changes. Which solution has more impact? Explain your reasoning for picking one solution over another. How could you refine one of your proposed solutions to further reduce environmental impact and loss of biodiversity while also addressing human needs?

Answers

Answer:

the screen shot is the answers when you select kitakami River region

Explanation:

sorry this isn't the full answer this is all have myself at the moment.

Answer:

Explanation:

the links are images of the answers

draw a diagram that tracks how the suns energy gets to a fox. In your diagram, label each organism as heterotroph or an autotroph

Answers

I have edited a picture from Google for you. Hope it helps. You just have to replace the tiger with a fox.

Hope it helps

The fox ( heterotroph) gets energy by eating other animals who in turn eats plants(autotroph)

What are heterotroph?Hetero- other and trophe- nourishment.Organism that eats plants or other animals are called heterotroph.What are autotrophs?Auto- self and trophe- nourishment.Organism that makes their own food is called autotrophs.

Hence, the diagram given below shows how the sun energy gets to a fox.

To know more about autotroph here

https://brainly.com/question/25420230

#SPJ2

Why is meiosis important for organisms?
It allows for genetic variation among organisms.
It determines which genes are dominant and which are recessive.
It produces genetically identical cells.
It provides a means of asexual reproduction.
IM TIMED

Answers

Answer:

A - It allows for genetic variation among organisms.

Explanation:

Its basically sex or sexual reproduction. Which later allows for genes to spread and vary. Which create families in animals and humans.

Because Meiosis is Sexual Reproduction

Hope this Helps!

:D

Which macromolecule and function are correctly matched? *

A. Lipids are used to build things like your hair, skin, nails, and muscles and are also
enzymes

B. Lipids are used for long term energy storage and carbohydrates are used for short
term energy storage.

C. Proteins and Lipids give us energy.

D. Carbohydrates contain your genetic information.

Answers

Answer: B. Lipids are used for long term energy storage and carbohydrates are used for short

term energy storage.

Explanation:

*****!!!! lots of points and brainliest!!!******** how do i find the codon and anti codon? :)​

Answers

Answer:

The way to find a codon is by arranging the sequence of nitrogenous bases of the mRNA in groups of three, the triplets. Once the codon is found, the anticodon corresponds to a complementary triplet to that codon.

Explanation:

Codon corresponds to a triplet of mRNA nitrogen bases encoding an amino acid. Anticodon is responsible for carrying amino acids to the ribosome, according to the information of the mRNA, and the sequence of its triple must be complementary to that of the codon mRNA.

If, for example, a codon of the mRNA is AUG, its anticodon of the tRNA must be UAC, that is, complementary. Then, for the indicated exercises:

Exercise 1:

DNA    ATACGAAATCGCGATCGCGGCGATTCGG mRNA    UAUGCUUUAGCGCUAGCGCCGCUAAGCC CODON         UAU|GCU|UUA|GCG|CUA|GCG|CCG|CUA|AGC|C- AntiCODON AUA|CGA|AAU|CGC|GAU|CGC|GGC|GAU|UCG|G- Amino acid    Tyr|Ala|Leu|Ala|Leu|Ala|Pro|Leu|Ser

Exercise 2:

DNA    TTTACGGCCATCAGGCAATACTGG mRNA    AAAUGCCGGUAGUCCGUUAUGACC CODON         AAA|UGC|CGG|UAG|UCC|GUU|AUG|ACC AntiCODON  UUU|ACG|GCC|AUC|AGG|CAA|UAC|UGG Amino acid     Lys|Cys|Arg|Stop|Ser|Val|Met|Thr

Cellular respiration refers to _____.
A releasing cellular energy through secretion
B the synthesis of cellular materials
C breathing
D the breakdown of sugar molecules in food to release energy

Answers

Answer:

D

Explanation:

Cellular respiration is a set of metabolic reactions and processes that take place in the cells of organisms to convert chemical energy from oxygen molecules or nutrients into adenosine triphosphate (ATP), and then release waste products.

Answer:

D. The breakdown of sugar molecules in food to release energy.

Explanation:

Cellular respiration is converting the glucose in your food to ATP in the mitochondria of the cell to produce energy for living.

Cyanite (Al2SiO5), quartz (SiO2), and leucite (KAlSi2O6) may be grouped together because they are all part of the largest mineral group called:

Answers

Answer:

Explanation:

Cyanite, quartz and lucite are all part of the potassium mineral group

The study of chemicals and bonds is called chemistry.

The correct answer to the question is potassium.

What are minerals?A mineral or mineral species is, broadly speaking, a solid chemical compound with fairly well-defined chemical composition and a specific crystal structure that occurs naturally in pure form. The geological definition of mineral normally excludes compounds that occur only in living beings.

According to the question, all these minerals belong to the potassium group.

For more information about the minerals, refer to the link:-

https://brainly.com/question/14688752

Smalles to greatest

Answers

Answer: cells, tissues, organs, organ systems, organism

Explanation:

Organ systems,cells,organism,tissues
I'm pretty sure I've did something like this before but yea good luck:)

For this assignment, you will first make a model of a DNA strand using pop beads. This DNA strand
codes for a protein, which determines a trait in an organism. Next, you will change the base sequence of
your model in three ways to show how mutations occur. Then, you will compare the base sequence of the
mutated models to sequences on a key provided by your teacher to find out whether the mutated strand
creates a protein that is beneficial, harmful, or neutral. Finally, you will answer some questions to
summarize what you have done in this project. The Student Worksheet on the last few pages of this
document will help you complete your assignment.
Background Information
DNA is the genetic material passed from parent to offspring. It is an important molecule because it carries
instructions used for producing proteins. These proteins determine how an organism looks and functions.
DNA is a double-helix molecule. The two sides of the molecule, its backbone, are made of sugar
molecules and phosphate molecules. These sides are connected by rungs made of nitrogen bases. The
nitrogen bases of DNA are adenine (A), thymine (T), cytosine (C), and guanine (G).
A gene is a segment of DNA that codes for a specific trait. The sequence of nitrogen bases in a gene is
copied from DNA into a strand of RNA in the nucleus of a cell. The RNA then moves out of the nucleus to
the ribosome. The ribosome uses the information that RNA copies from DNA to produce proteins that
have specific shapes and functions. The shapes of proteins help them perform their job. If the shape of
the protein is changed, the protein may not be able to perform its function. A mutation, which is a
permanent change in the DNA sequence in a gene, may change the shape of the protein it codes for.
Types of mutations include substitution, insertion, and deletion. The effects of mutations on organisms
may be beneficial, harmful, or neutral.

Answers

Answer:

This type of mutation occurs when one or more base pairs are added to the gene sequence.

✔ insertion

This type of mutation occurs when one or more base pairs are removed from the gene sequence.

✔ deletion

This type of mutation occurs when one or more base pairs take the place of other base pairs in the gene sequence.

✔ substitution

Question:

Do you remeber the answer you turned in for this? If you do, can you please give it to me????? That would help a lot

Give two reasons why photosynthesis in plants slows down then stops during the fall then winter.

Answers

Answer: In the winter and fall there is less sunlight and there is less rain

There is a decline in photosynthesis after the sun sets in the winter and fall seasons. There is a decline of the enzymes in the plants that are responsible for the biochemical reaction.

These don't tend to work so so well during the winter cold winds blowing slows down the plant respiration process and hence the less photosynthesis to for the plants. Hence few sugars are not turned into metabolism.

Learn more about why photosynthesis in plants slows down.

https://brainly.com/question/1050630.

What happens over time to rock that is stressed?
A The rock becomes gravel
D. The color of the rock changes.
C. The rock melta to liquid
D. The shape of the rock deforms
SUMMIT

Answers

Answer:

The rock becomes gravel

Explanation:

Answer:

The shape of the rock deforms

Explanation: i took a quiz on a.pex and it was right

Which of the following explains why a mountain can become flat after millions of years?

Weathering and erosion cause the soil from the mountain to erode down the mountain's slope.

Heat from the sun causes the soil to dry out, decreasing the mountain's volume and causing it to sink

Animals walking and running across the land compact the soil over time until it becomes flat

The mountain crumbles away after losing all its nutrients because there are too many trees

Answers

weather and erosion i believe

Answer:

weather and erosion

Explanation:

how does the nervous system send messages to the other parts of the body

Answers

Answer:

by signals that the nervous system sends to the brain

Explanation:

QUICK! 30 POINTS

D is crossed out because it is wrong.

Answers

Answer:

C. There is a loss in energy

Explanation:

what adaptations facilitated movement of tetrapods to land - be sure to describe challenges that these adaptations helped them overcome.

Answers

Answer:

The second neck vertebra evolved to allow rotation of the neck for moving the head left and right. As tetrapod species continued to evolve on land, adaptations included seven or more vertebrae, allowing increasing neck mobility.

Explanation:

Which of the following is NOT a function of the skeletal system?

A, Providing a framework for muscles

B. Creating new blood cells

C. Fighting disease

Answers

Answer:

From help from another user my answer was wrong to begin with the answer is C.

Explanation:

Most blood cells are created in bone marrow, the spongy substance found inside the bone structure.

B is a function of the skeletal system

The bones make the frame work of the body which allows us to stand and keep structure instead of being like slime.

A is a function of the skeletal system

ONCE AGAIN: The correct answer is C

Other Questions
what are the intangible property that is protected by law which an enterpreneur should consider when starting up a business for the function of F defined by f (x) = x + 8. what is the value of x when f (x) = 10 WILL GIVE BRAINLIEST TO THE FIRST CORRECT ANSWERmatch these items1. elected by all state voters2. free mail privileges3. put aside legislation4. floor leader of the majority party5. first representative government in the colonies6. number required to do buisiness7. guaranteed tights of the peopleword bankhouse of burgessesmajority leaderfrankingbill of rightspigeonholequorumcongressman-at-large Find intervals of which I will mark brainliest if i like the tulaTula tungkol sa ancient gree sa mundoaas who invite computer ? PLEASE HELP Which of the following are ordered pairs for the given function?Select all that apply.f(x) = 1 + x(1, 2)(3.3)0 (0, 2)(1, 0)(0,1) what was the political party of the president elected in 2020 Which long-term health effect is highly associated with a diagnosis of anorexia nervosa?bone fracturesdehydration problemsnervous system problemsschizophrenia Besides helping to discover the structure of DNA, describe two other contributions Rosalind Franklin made to the world of science. Bob rides his bike with a constant speed of 10 miles per hour. How long will he take to travel a distance of 15 miles? 4. Divide, using synthetic division: 16x^3 +80x^2+x+5/x+5Part l: Show the proper setup of the problem, placing coefficients and divisorsin their proper places (4 points)Part II: Carry out the division problem, and write the quotient in properpolynomial notation. (6 points) what does this mean?? 1 pointA manufacturing plant has 60supervisors. If 27 of the supervisors aremen, thenO 45% are women55% are men55% are womenO 75% are menO 75% are women In December 2005: Currency held by individuals and businesses, $724 billion Money market funds and other deposits, $711 billion. Savings deposits, $3,622 billion Time deposits, $974 billion Checkable deposits owned by individuals and businesses, $638 billion Traveler's checks held by individuals and businesses, $7 billion Calculate Ml and M2 in December 2005. M1 in December 2005 was $______ billion. M2 in December 2005 was $ ______billion. Bee movie pt. 2Oan anyone work on the Krelman? Of course. Most bee jobs are small ones. But bees know that every small job, if it's done well, means a lot. But choose carefully because you'll stay in the job you pick for the rest of your life. The same job the rest of your life? I didn't know that. What's the difference? You'll be happy to know that bees, as a species, haven't had one day off in 27 million years. So you'll just work us to death? We'll sure try. Wow! That blew my mind! "What's the difference?" How can you say that? One job forever? That's an insane choice to have to make. I'm relieved. Now we only have to make one decision in life. But, Adam, how could they never have told us that? Why would you question anything? We're bees. We're the most perfectly functioning society on Earth. You ever think maybe things work a little too well here? Like what? Give me one example. I don't know. But you know what I'm talking about. Please clear the gate. Royal Nectar Force on approach. Wait a second. Oheck it out. - Hey, those are Pollen Jocks! - Wow. I've never seen them this close. They know what it's like outside the hive. Yeah, but some don't come back. - Hey, Jocks! - Hi, Jocks! You guys did great! You're monsters! You're sky freaks! I love it! I love it! - I wonder where they were. - I don't know. Their day's not planned. Outside the hive, flying who knows where, doing who knows what. You can'tjust decide to be a Pollen Jock. You have to be bred for that. Right. Look. That's more pollen than you and I will see in a lifetime. It's just a status symbol. Bees make too much of it. Perhaps. Unless you're wearing it and the ladies see you wearing it. Those ladies? Aren't they our cousins too? Distant. Distant. Look at these two. - Oouple of Hive Harrys. - Let's have fun with them. It must be dangerous being a Pollen Jock. Yeah. Once a bear pinned me against a mushroom! He had a paw on my throat, and with the other, he was slapping me! - Oh, my! - I never thought I'd knock him out. What were you doing during this? Trying to alert the authorities. I can autograph that. A little gusty out there today, wasn't it, comrades? Yeah. Gusty. We're hitting a sunflower patch six miles from here tomorrow. - Six miles, huh? - Barry! A puddle jump for us, but maybe you're not up for it. - Maybe I am. - You are not! We're going 0900 at J-Gate. What do you think, buzzy-boy? Are you bee enough? I might be. It all depends on what 0900 means. Hey, Honex! Dad, you surprised me. You decide what you're interested in? - Well, there's a lot of choices. - But you only get one. Do you ever get bored doing the same job every day? Son, let me tell you about stirring. You grab that stick, and you just move it around, and you stir it around. You get yourself into a rhythm. It's a beautiful thing. You know, Dad, the more I think about it, maybe the honey field just isn't right for me. You were thinking of what, making balloon animals? That's a bad job for a guy with a stinger. Janet, your son's not sure he wants to go into honey! - Barry, you are so funny sometimes. - I'm not trying to be funny. You're not funny! You're going into honey. Our son, the stirrer! - You're gonna be a stirrer? - No one's listening to me! Wait till you see the sticks I have. I could say anything right now. I'm gonna get an ant tattoo! Let's open some honey and celebrate! Maybe I'll pierce my thorax. Shave my antennae. Shack up with a grasshopper. Get a gold tooth and call everybody "dawg"! I'm so proud. - We're starting work today! - Today's the day. Oome on! All the good jobs will be gone. Yeah, right. Pollen counting, stunt bee, pouring, stirrer, front desk, hair removal... - Is it still available? - Hang on. Two left! One of them's yours! Oongratulations! Step to the side. - What'd you get? - Picking crud out. Stellar! Wow! Oouple of newbies? Yes, sir! Our first day! We are ready! Make your choice. - You want to go first? - No, you go. Oh, my. What's available? Restroom attendant's open, not for the reason you think. - Any chance of getting the Krelman? - Sure, you're on. I'm sorry, the Krelman just closed out. Wax monkey's always open. The Krelman opened up again. What happened? A bee died. Makes an opening. See? He's dead. Another dead one. Deady. Deadified. Two more dead. Dead from the neck up. Dead from the neck down. That's life! Oh, this is so hard! Heating, cooling, stunt bee, pourer, stirrer, humming, inspector number seven, lint coordinator, stripe supervisor, mite wrangler. Barry, what do you think I should... Barry? Barry! All right, we've got the sunflower patch in quadrant nine... What happened to you? Where are you? - I'm going out. - Out? Out where? - Out there. - Oh, no! I have to, before I go to work for the rest of my life. You're gonna die! I WILL GIVE BRAINLIEST *easy questionIf a visitors comes to your house for the first times, what directions could you give him or her how to use your tv and how to find the TV remote control, among other things? Which is better, in most situations, a bumper switch or a limit switch, and why? Can someone help me with this? Find the slope from the pair of points. (-5, -1) (5,-4)