Need help right nowwww!!

Need Help Right Nowwww!!

Answers

Answer 1
C :)))))))))))))))...... yu welcome
Answer 2
It would be C.what happens to the substrate as temperature rises

Hope this helps

Have a great day/night

Related Questions

What is the earth?
What is the atomosphere

Answers

Answer:

Earth's atmosphere is a layer of gases surrounding the planet Earth and retained by the Earth's gravity.

Explanation:

It contains roughly 78% nitrogen and 21% oxygen 0.97% argon and carbon dioxide 0.04% trace amounts of other gases, and water vapor. This mixture of gases is commonly known as air.

Answer:

Earth is the third planet from the Sun and the only astronomical object known to harbor life. About 29.2% of Earth's surface is land consisting of continents and islands.Earth's atmosphere is a layer of gases surrounding the planet Earth and retained by the Earth's gravity. It contains roughly 78% nitrogen and 21% oxygen 0.97% argon and carbon dioxide 0.04% trace amounts of other gases, and water vapor. This mixture of gases is commonly known as air.

Explanation:I cited this as my claim because it shows and explains the question that is giving.

Will the geosphere suffer long term or short term damage from a forest fire? Explain.

Answers

Long term I think because it takes a while for forest to be filled again

Which statement best explains the myth about how Romulus and Remus founded Rome?

Answers

After deciding to build a town on one of seven hills, Romulus and Remus had to decide which hill to base it off of and Romulus chose Palatine hill and Remus chose Aventine Hill, Later leaving Romulus to kill Remus in a fight and build the city on Palatine hill hence the name Rome.

Answer: Romulus defeated his brother, then founded Rome on one of the seven hills.

Explanation: Despite there is no answer choices, I'm thinking back on a little quiz I took, and it had the same exact question with the same exact answer choices, and that was the correct answer

Any one free
InboX me (◍•ᴗ•◍)❤​

Answers

Answer:

hiii

Explanation:

Below are two sequences of a segment of DNA.
Normal sequence TTA AAA GGA
Mutated sequence CTT AAA AGG A
Which type of mutation has occurred?

Answers

I think it’s insertion

.
Why are some sources of sugar better than others?

Answers

Explanation:

[tex]\huge{\underbrace{\overbrace{\mathfrak{\pink{Answer:❣}}}}}[/tex]

Whether an added sugar contains more or less fructose versus glucose has little impact on health. (An exception may be people with diabetes who need to control their blood glucose, in which case a higher-fructose, lower-glucose sugar may be preferable

Answer:

Some sugar that's made is usually take and unhealthy, but other sources can be purely made with no artificial s added to it making it fake.

Select the correct blsector of the segment.
M
А
B
M
2
M
D
M

Answers

Answer:

B

Explanation:

because it has a slant p and q bisector

Which is true?
A.Ocean currents affect temperatures on land.
B. The ocean has no effect on the temperature on the land.
C. Ocean water does not move between locations.
D. All ocean water is the same temperature.

Answers

Answer:

I think it's A.

Explanation:

Sorry If I'm wrong

the correct answer is A, hope this helps :))

which process do plants and animals share in common?

A. absorption if water

B. cellular respiration

C. photosynthesis

D. transpiration​

Answers

Plants and animals both complete the process of cellular respiration

Cellular respiration process do plants and animals share in common. So, the correct option is (B).

What is Cellular respiration?

Cellular respiration is defined as the process that occurs in the mitochondria of all living organisms. In this process, both plants and animals break down simple sugars into carbon dioxide and water and release energy in the form of adenosine triphosphate (ATP).

This process is a set of metabolic reactions that occur inside cells to convert the biochemical energy obtained from food into a chemical compound called adenosine triphosphate (ATP). Metabolism define as the set of chemical reactions carried out to maintain the living state of cells in an organism which can be divided into two categories:

CatabolismAnabolism

Thus, Cellular respiration process do plants and animals share in common. So, the correct option is (B).

Learn more about Cellular respiration, here:

https://brainly.com/question/29760658

#SPJ2

What changes occur to the ratio of surface area to volume as a cell
grows?

Answers

Answer:

As a cell grows, its surface area-to-volume ratio decreases

1.What is the adaptation that is beneficial to organisms in the Mountain Rock environment?

2.What is the adaptation that is beneficial to organisms in the Desert Sand environment?

Answers

Answer:

Dense hair and thick skin.

Thin skin and Nocturnal behavior.

Explanation:

Dense hair and thick skin are the adaptation that is beneficial to organisms that is present in the environmental condition of Mountain Rock because on Mountain Rock, the temperature is very low so organisms needs something which make them warm, while on the other hand, thin skin and Nocturnal behavior are the adaptations that is beneficial to organisms in the Desert Sand environment because temperature is very hot.

Nitrogen from animal wastes or plant an animal tissue
O must be fixed near leguminous plants,
O is lost from the system.
O is fixed by bacteria and fungi in the soil.
O is already fixed and can be used.

Answers

System is okay better

Nitrogen from animal wastes or plant an animal tissue  is fixed by bacteria and fungi in the soil.

So, option C is correct one.

How plants and animals get nitrogen ?Since our atmosphere contains 78% of nitrogen but it is very difficult  to take directly by plants and animals.Nitrogen is very essential for all living organism.Plants take nitrogen from soil.Some bacteria and fungi are present in the soil who fix nitrogen from the atmosphere and convert it into nitrogen compound.Then this nitrogen from the soil by root system of the plants.Now plant use this nitrogen for synthesis of proteins and other compounds.Animals who feed plants gets this proteins and other nitrogen compound from plants.When plants and animals die , fungi and bacteria present in the soil converts this nitrogenous waste into nitrogenous compound and reuse of nitrogenous compound is repeated again.

learn about nitrogenous waste,

https://brainly.com/question/9423629

#SPJ2

The cell membrane is made up of a lipid bilayer as shown in the model. Which of the following describes the structure and function of the cell membrane?
56 points!!!!!!

Answers

Answer:

The hydrophilic head groups of the lipid molecules are exposed to the outside of the cell and the cytoplasm, which is a water-like environment. The hydrophobic tails form an oily layer inside the membrane that keeps water out of the cell

Explanation:

Cell membrane is selectively permeable in nature. The hydrophilic head groups of the lipid molecules are exposed to the outside of the cell, which is a water-like environment and hydrophobic tails form an oily layer inside the membrane. Thus, correct option is A.

What is Plasma Membrane?

Plasma membrane is also known as the cell membrane. It is found in all types of cells that separates the interior of the cell from the outside environment. In bacterial and plant cells, a cell wall is also found which covers the cell membrane.

The cell membrane consists of three classes of amphipathic lipids: phospholipids, glycolipids, and sterols. Plasma membrane is selectively permeable in nature, it allows only some material to pass through it while blocks other material from entering through it.

The portions of the integral membrane protein found inside membrane are hydrophobic, while portions which are exposed to the cytoplasm or extracellular fluid tend to be hydrophilic in nature. Molecules that are hydrophobic can easily pass through the plasma membrane while hydrophilic particles cannot pass through the membrane easily.

Therefore, correct option is A.

Learn more about Plasma membrane here:

https://brainly.com/question/24588191

#SPJ5

8.
What is meant by the term base-pairing? How is base-paring involved in DNA replication?

Answers

Answer: Hydrogen bonds form only between specific base pairs. ase pairing ensures that the complementary strands produced are identical to the original strands.

Explanation:

The West Bank, Gaza Strip, Sinal Peninsula, and Golan Heights were conquered by Israel during the

A. first World War

B. 1048 Arab Israell War

C. Islamie Hevolution

D. Six Day War​

Answers

Answer:

D, The Sixth Day War

Enjoy :3

Answer:

D the six day war

Explanation:

Is playstatium a mineral?​

Answers

no, thy substance tis’ no mineral

which is more specific chordata or Eukarya​

Answers

Chordata

:):):):):):)

What environment does ambulocetus live in?

Answers

Answer:

northern Pakistan, in long-lost coastal shallow seas and brackish rivers

Explanation:

i'm hoping this is right

What is the phase change from gas to liquid?
A. Sublimation
B. Condensation
C. Vaporization
D. Transpiration

Answers

Answer:

Condensation

Explanation:

Condensation is the phase change from gas to liquid. For example, water vapor condenses when you are taking a shower because wet spots show up on a mirror after taking a shower.

Answer:

Condensation

Explanation:

Sublimation is when a solid turns into a gas. Condensation is when water in the air collects to form droplets that gather on a surface/object. Vaporization is when a liquid forms into a gas. Transpiration is a thing in plants where water transfers throughout the plant.

The more a muscle is stimulated (working), the smaller it will get.
O
true
О
false

Answers

Answer: true

Explanation: Sometimes, a subset of muscle fibers is activated, depending on how much force is needed. When the muscle is stimulated, calcium ions are released from its store inside the sarcoplasmic reticulum, into the sarcoplasm (muscle ). ... The SR is smaller and less elaborate, and stores less calcium ions.


Mass measures the amount of ______ in a substance
or an object.

a matter
b space
c gravity
d vapour

Answers

Answer:

theianswer to this is A. Matter

Please help :) really stuck

Answers

The results show Sarah could feel tired because her red blood cells (2,700,000) and platelets (245,000) are below the normal levels (3,800,000 and 250,000). Her white blood cells (9,000) are above the normal level (8,500)

Sorry if wrong

Connect the organs of the body listed in column Awith its function in column B. Write the LETTER of the correct answer on the blank.

Column A

1. Brain 2. Heart 3. Lung 4. Stomach 5. Small intestine 6. Kidney 7. Bone 8. Muscle 9. Blood 10. Large intestine

Column B

A. A.bsorbs water and electrolytes b. Absorbs c.pumps blood around the body d.filters blood and produce urine e.gets O2 and remove CO2 from the blood F.allows humans to move g.controls thoughts, memory and other organs h.supports and protects other organs I.transports the nutrients and oxygen to the lungs and tissues j.temporarily stores foods​

Answers

gcejbdhfia........ ........

You want to make 1 ton ration of an 18% protein ration using corn (12%) and soybean meal (22%). How much of each will he have to mix together? Show your work for full credit.

Answers

Answer:

To make a 1 ton ration of an 18% protein ration using corn (12%) and soybean meal (22%), 0.6 tons of soybean meal and 0.4 tons of corn are needed

Explanation:

Using the Pearson’s Square calculations:

1. Subtract across the diagonal:

a. 18% - 12% = 6 parts soybean meal

b. 18% - 22% = 4 parts corn

2. Sum the parts:

a. 6 parts soybean meal + 4 parts corn = 10 totalparts

3. Divide each part by the total to calculate the percentage of each feed to include in the ration:

a. 6 parts soybean meal ÷ 10 total parts * 100 = 60.0% soybean meal

b. 4 parts corn ÷ 10 total parts * 100 = 40.0% corn

So, to make 1 ton ration of an 18% protein ration using corn (12%) and soybean meal (22%),

60% of soybean meal is needed = 60/100 * 1 ton = 0.6 tons of soybean meal

40% of corn is needed = 40/100 * 1 ton = 0.4 tons of corn

o
1. Which criteria are used to classify amphibians into orders?

Answers

Answer:

They are classified into three orders: frogs and toads, salamanders and newts, and caecilians.

Approximately 8,100 species of living amphibians are known. First appearing about 340 million years ago during the Middle Mississippian Epoch, they were one of the earliest groups to diverge from ancestral fish-tetrapod stock during the evolution of animals from strictly aquatic forms to terrestrial types. Today amphibians are represented by frogs and toads (order Anura), newts and salamanders (order Caudata), and caecilians (order Gymnophiona). These three orders of living amphibians are thought to derive from a single radiation of ancient amphibians, and although strikingly different in body form, they are probably the closest relatives to one another.

Developing a new vaccine takes about 5-10 years. So how is it possible to develope Corona vaccine so quickly?​

Answers

Answer:

vaccines were designed by using new technologies (i.e., RNA-based vaccines and adenovirus-based vaccines)

Explanation:

RNA-based vaccines are vaccines based on the delivery of specific messenger RNA (mRNA) sequences that are capable of encoding only one viral protein, thereby preventing the complete viral cycle/replication. Subsequently, this protein is recognized by the immune system that generates memory immunity by synthesizing specific antibodies against this protein (in this case, the spike S protein). On the other hand, adenovirus-based vaccines are vaccines designed by inserting a transgene cassette into an adenovirus which is used as vector to produce one specific viral protein inside the host. Like mRNA vaccines, this antigenic viral protein is then recognized by the immune system in order to produce antibodies against a defined protein epitope, thereby producing memory immunity.

What is the definition of a DNA Polymerase

A. Enzyme involved in DNA replication that joins individual nucleotides to produce a DNA molecule
B. An enzyme that unwinds the DNA double helix during DNA replication
C. A class of nucleotides that includes adenine and guanine.
D. A bond between complimentary base pairs in DNA​

Answers

A. I hope this hopes

What does order mean in biology

Answers

Answer:

A taxonomic rank used to classify organisms that is typically lower than the class and consists of families with comparable natures or characteristics.

OAmalOHopeO

which statement describes what happens with ATP during glycolysis?

A) more ATP is produced than is used

B) glycolysis splits ATP

C) more ATP is used than is produced

D) glycolysis does not make any ATP

Answers

Answer:

A. more ATP is produced than used

Explanation:

Regulation of glycolysis

Several steps in glycolysis are regulated, but the most important control point is the third step of the pathway, which is catalyzed by an enzyme called phosphofructokinase (PFK). This reaction is the first committed step, making PFK a central target for regulation of the glycolysis pathway as a whole^1  

1

start superscript, 1, end superscript.

PFK is regulated by ATP, an ADP derivative called AMP, and citrate, as well as some other molecules we won't discuss here.

ATP. ATP is a negative regulator of PFK, which makes sense: if there is already plenty of ATP in the cell, glycolysis does not need to make more.

AMP. Adenosine monophosphate (AMP) is a positive regulator of PFK. When a cell is very low on ATP, it will start squeezing more ATP out of ADP molecules by converting them to ATP and AMP (ADP + ADP \rightarrow→right arrow ATP + AMP). High levels of AMP mean that the cell is starved for energy, and that glycolysis must run quickly to replenish ATP^2  

2  squared.

Nerve cells that can detect chemicals are:
A. chemoreceptors.
B. chemtransductors.
C. limbic system indicators.
D. neurotics.

Answers

Answer:

its Chemoreceptors

Explanation:

A chemoreceptor, also known as chemosensor, is a specialized sensory receptor cell which transduces a chemical substance to generate a biological signal.

Other Questions
Tell about a time in your life when you were very scared. It can be an event or something you were worried about. 2 sentences.Please put something I have nothing- 2.92 x 10^-15/(5.6 x 10^-3) (4.16 x 10^9) Find the volume of the following figure Nate needs at least 15 pounds of chocolate to make his chocolate fountain work. He already has 8 pounds of chocolate. What is the smallest amount that he can get to make the chocolate fountain work? Write an inequality and solve. Let c represent the amount of chocolate Nate needs to get. Pls pls help I dont have time HELP ASAP. It also detects if its right or wrong. Part i)Which of the following is the best abbreviation for the word Government?a.) GOVMTb.) GVRNTc.) GOVd.) GOV'TPart ii)In 100 words or less, describe what the U.S Government is/does and why it is/isn't so important. Briefly state your beliefs/views and facts about the U.S Government. You may use any and all online resources to answer this question. Include as much detail as possible in your short answer. Which number is irrational? . Complete the quotation:"I am ...with him in this world" From jekyll and Hyde The function of a retail of purchasing cooperative or "co-op" is toCorrect answer A. obtain lower prices for members.Incorrect answer B. work to improve the image and working conditions of members.Incorrect answer C. save income taxes for members.Incorrect answer D. sell the goods or services produced by members. What does it mean to "Psych yourself up?" How does this term affect the meaning of the text Find three ratlos equivalent to the ratio described in the situationThe ratio of cups of water to cups of milk in a recipe is 1 to 4Three equivalent ratlos are 2 to3 to4 to When a cricket ball is thrown vertically upwards, it reaches a maximum height of 15 metres. (a) What was the initial speed of the ball ? (b) How much time is taken by the ball to reach the highest point ? (g=10 ms -2 What caused president roosevelt to sign into law meat Inspection act? who is a better band1:One direction2: 5 seconds of summer 3: BTS4:Little mix5: other Which of the following describes hetereogeneous mixture... 1)A mixture that is easily separated, the components are different sixes and unevenly mixed. 2) A mixture that is very difficult to separate, the contents are evenly mixed and the mixture looks like a substance Light rays from the sun are called: solar energy heat energy chemical energy a circle has a center at (-2,7). if a point on the circle has coordinates (3,-1) then which of the following would be the length of the radius of the circle write the code for RNA from this DNA STRAND :AAAAAATTTTTTCCCGGGGTTTATATATC if you answer some of them ill appreciate it ( you don't have to answer all of them ) What can cause a significant change in someones life