No they are not breathing. And they have no arms or legs … Where are they? You know what? If we come across somebody with no arms or legs, do we bother resuscitating them? I mean, what quality of life do we have there?

Answers

Answer 1

Answer:

YESSSSSS love the office

Explanation:


Related Questions

Consider an experiment in which blood pressure is measured in subjects treated with an experimental drug. Which is the dependent variable

Answers

Answer: Blood pressure

Explanation:

The dependent variable is the variable that is affected by the independent variable. It is the variable that changes in response to the another variable.

In this scenario, the blood pressure is being measured to see any changes that have occurred as a result of a treatment with an experimental drug which would make blood pressure the dependent variable.

The dependent variable will be blood pressure .

There are two types of variable known as the dependent and independent

variable.The dependent variable depends on the value or effect of the

independent variable which could be constant or altered.

In this scenario, the independent variable is the experimental drug as its

effect or value causes a change in the dependent variable which is the blood pressure. This is the variable that is usually recorded during experiments.

Read more on https://brainly.com/question/1670595

7. Hip dysplasia is an abnormal growth of the bones of the hip joint.
O
True
O
False

Answers

Answer:

brainliest plsssss

Explanation:

Hip dysplasia is an abnormality of the hip joint where the socket portion does not fully cover the ball portion, resulting in an increased risk for joint dislocation. Hip dysplasia may occur at birth or develop in early life. Regardless, it does not typically produce symptoms in babies less than a year old.

Other names: Developmental dysplasia of the ...

Risk factors: Family history, swaddling, breech ...

The answer to this problem is true

On what does the World Health Organization base its standards?

research

first–hand observations
what other organizations are doing

solutions that make the most money

Answers

The World Health Organization base its standards by first hand observations what other organizations are doing.

Answer:

Its research

Explanation:

I got it right in edge

1. As a medical professional, with whom are you allowed to share a
patient's medical records according to the Health Insurance
Portability and Accountability Act?

Answers

You are only allowed to share on Need To Know Basis. Only health care workers.

true or false
gestational diabetes is indicated by a decrease in blood or urine glucose levels

Answers

I think the answer is false

:):):):):):)

Answer:

That is false

Because pregnancy causes the body’s need for energy to change, blood sugar levels can change very quickly

A psychosomatic disease is best defined as a disease in which
there are no observable symptoms.
mental factors do not affect overall health.
the body and mind contribute to an illness.
stress is unrelated to physical conditions.

Answers

Answer:

Body and mind contribute to the illness

Explanation:

50 points brainliest I'm watching to wait explain the difference between essential body fat and storage body fat​

Answers

functioning and good health. Storage body fat does three basic functions
1) Insulator to retain body heat
2) energy substrate for metabolism
3) padding against physical trauma to the body
Hope this helped
The main difference between the essential body fat and storage body fat is that essential fat helps in maintaining several body functions and in the transportation of vitamins and several molecules. The storage body fat accumulates in the body and causes several health problems
hope this helped

Compare the duration of actions of warfarin (Coumadin) and Enoxaparin(Lovenox) and explain the reason the provider switched to Enoxaparin at this time

Answers

Answer:

The duration of the effect of Warfarin is prolonged for 2 to 5 days, while the effect of enoxaparin can be maintained for a maximum of 24 hours. The provider probably switched to Enoxaparin to better control the anticoagulant effect.

Explanation:

Warfarin (Coumadin) is an orally administered anticoagulant that indirectly interferes with the action of vitamin K-dependent coagulation factors II, VII, IV and X. The effect as an anticoagulant can begin after 8 hours of administration, reaching a maximum effect in 72 hours, and an effect that can last up to five days.

Enoxaparin (Lovenox) is an anticoagulant administered subcutaneously, whose effect is to inhibit the activity of coagulation factor Xa. Its effect is rapid after administration, and its half-life is relatively short —about 4 to 6 hours— so that the effect can remain for no more than 24 hours.

When a provider switchs the indication of warfarin to enoxaparin, it is to achieve better control of anticoagulation, use it for a limited time or without affecting other mechanisms of blood coagulation.

Oxygenated blood enters the heart where?

Answers

Oxygen-rich blood enters the hearth by the pulmonary veins from the lungs. The blood flows through the left atrioventricular valve.

Oxygenated blood and hearth

Oxygen-rich blood enters the hearth by the pulmonary veins from the lungs.

The pulmonary veins from the lungs act to transport oxygen-rich blood from the lungs to the heart.

This blood then flows via the left atrioventricular valve in order to enter in the left ventricle.

The left atrioventricular valve is one of the four heart valves, which is located between the left atrium and the left ventricle.

Learn more about blood circulation here:

https://brainly.com/question/988627

Which choice shows the atomic number of an element in Group 2?

Answers

Answer:

BRAINLIEST PLZZZZZ

Explanation:

The alkaline earth metals are six chemical elements in group 2 of the periodic table. They are beryllium (Be), magnesium (Mg), calcium (Ca), strontium (Sr), barium (Ba), and radium (Ra).

rrect A pregnant pharmacy technician is working at the local hospital pharmacy.
Which of the following medications should she avoid handling?
Ketoconazole?

Answers

Answer:

Methotrexate, finasteride, dutasteride, and misoprostol seem like the ones that come up most frequently

Explanation:

Aaron, a healthcare worker, washed his hands, gave a patient a needle injection, and then disposed of the needle in a sharps container. Which best describes the error Aaron made in following standard precautions?

A. He should have placed the needle in the biohazards bin.
B. He should have put gloves on before working with the needle.
C. He should have contacted the CDC to report the use of a needle.
D. He should have checked the MSDS before disposing of the needle.

Answers

Answer: the answer is B

Choose the correct location and hand placement to perform abdominal thrusts on a choking child

Answers

Answer:Stand or kneel behind the child and wrap your arms around his or her waist.

Explanation:

kneel behind the child and place your fist on their chest with your other hand grabbing your fist

hailey has recently joined the hospital

Answers

Answer:

Why?? What's happening?

is hailey okay ? hope she’s well

5. If G. H. has mild-to-moderate chronic back pain one year after his accident, explain the pain management medications you would suggest to improve his quality of life and why you selected those particular medications.

Answers

Answer: acetaminophen , aspirin, ibuprofen and naproxen

Explanation: aspirin, ibuprofen and naproxen are most commonly used to treat musculoskeletal pain. Side effects may include stomach upset or bleeding problems.Acetaminophen is also commonly used to treat mild to moderate pain. Opioids produce the greatest pain relief but they have serious side effects of opioid tolerance and addiction. When a patient stops taking opioids, he or she may get withdrawal symptoms such as diarrhea, nausea, vomiting, anxiety and irritability

Bone healing may be impaired by a. excessive vitamin C. b. nicotine use. c. immobilization. d. a high-protein diet.

Answers

Answer: b. nicotine use

Explanation:

Studies have shown that smoking reduces the speed at which bones heal from injuries and even though the data is sometimes conflicting, nicotine has been blamed for this impairment.

Vitamins heal bones and so do protein so options a and d are incorrect. Being immobilized gives bones the chance to heal so option c is incorrect as well.

Many people who are in favor of alternative medicine claim that large doses of vitamin C introduced into a vein speed up the healing of surgical wounds. Describe an experiment to test this hypothesis by answering questions 1-4

Answers

Can we see questions 1-4?

What process move sound waves to the oval window? What is the function of the oval window?

Answers

Answer:

The pressure waves strike the tympanum, causing it to vibrate. The mechanical energy from the moving tympanum transmits the vibrations to the three bones of the middle ear. The stapes transmits the vibrations to a thin diaphragm called the oval window, which is the outermost structure of the inner ear.

Explanation:

The eardrum is connected to the malleus, one of three small bones of the middle ear. Also called the hammer, it transmits sound vibrations to the incus, which passes them to the stapes. The stapes pushes in and out against a structure called the oval window

uwu
TwT

If I drink Pepsi to swallow a pill.. ( Tylenol ) what will happen?

I don't feel like getting up from where I am.. and all i have Is Pepsi, someone please answer my question above? Thank you!

Answers

You will prob be fine, if you have enough energy to get up, I would say grab some water and take it back to where you were. Eat some food too, if you have enough spoons. (Look up the spoon theory)

5. LSD is produced from ergot, a fungus that is found on some plants and grasses.
True
False

Answers

Answer:

That would be true.

Explanation:

With respect to proteins, the quaternary structure refers to the:

*

Answers

Number and arrangement

What is the difference between a disease and a disorder?

A) a disease results from a harmful agent being introduced to the body, while a disorder does not result from a particular external agent.

B) a disease is a condition that may strike people of all ages, while a disorder strikes only the elderly
population.

C) a disease is a life-threatening condition, while a disorder is only uncomfortable.

D) a disease is a short-term condition, while a disorder is a long-term condition.

Answers

Answer:

I would say D.

Explanation:

(I'm sorry if this is wrong. Please correct me if so.) Good luck!

A disease is different from a disorder as a disease is a short-term condition, while a disorder is a long-term condition. Thus, the correct option is D.

What is the difference between disease and disorder?

A disease is a harmful deviation from the normal structural or functional state of an organism. It is generally associated with certain signs and symptoms and it is different in nature from the physical injury. An organism affected with disease commonly exhibits signs or symptoms which are indicative of its abnormal state.

A disorder is a collection of signs and symptoms, however it has known to have associated features which are presumed to be related. Some common disorders are anxiety, including panic, obsessive-compulsive disorder, and phobias, depression, bipolar disorder, and other mood disorders.

Therefore, the correct option is D.

Learn more about Disease here:

https://brainly.com/question/8611708

#SPJ5

why do people feel good when it rains

Answers

Vice quotes therapist and anxiety and depression specialist Kimberly Hershenson, who explains, "Rain produces a sound akin to white noise. The brain gets a tonic signal from white noise that decreases this need for sensory input, thus calming us down. Similarly, bright sun tends to keep us stimulated."
I- good question...
I guess it's because of the humidity, the feeling can be calming.

In doubles, one serves every _________ game with the serve alternating between opponents between each game?
Group of answer choices

fifth

first

fourth

second

Answers

4th

i took quiz you are welcome

Fourth is the answer

The server may serve anytime he/she is ready?
Group of answer choices

True

False

Answers

Answer:

if it is a waitress then they have to wait until the guest is ready to serve so false

Explanation:

How many grams of nacl are in 750 ml of 1/2 ns? (answer must be numeric; no units or commas; include a leading zero when answer is less than 1.)?

Answers

Answer:

0.4 grams

Explanation:

devision

Which of the following is in compliance with
medical ethics?
A doctor tells a patient about the side effects
before starting a new treatment.
A doctor starts a new treatment before telling
the patient about its side effects.
A doctor tells a patient that there is no point
in giving informed consent, since the patient
needs the treatment to live.
DONE

Answers

Answer:a

Explanation:

The game starts when one person serves from anywhere behind the __________.
Group of answer choices

back row

sideline

baseline

anywhere

Answers

Answer:

baseline

Explanation:

l think hope that helps

Behind the baseline :)

Define the term tissue and discuss the four principal types of tissue, the base functions of each and the process by which they develope! ​

Answers

Answer:

A tissue is an ensemble of similar cells and their extracellular matrix from the same origin that together carry out a specific function.

There are 4 basic types of tissue: connective tissue, epithelial tissue, muscle tissue, and nervous tissue

Connective tissue supports other tissues and binds them together (bone, blood, and lymph tissues). Epithelial tissue provides a covering (skin, the linings of the various passages inside the body).

A collection of cells with a comparable structure and a predetermined purpose is referred to as a tissue.

Based on structural and functional similarity, tissues are grouped into four basic types. Epithelial, connective, muscular, and neural tissues fall under these groups. Together, the fundamental tissue types support the maintenance and overall health of the human body. Therefore, any alteration to a tissue's structure can result in damage or illness.The term "epithelial tissue" refers to collections of cells that line internal cavities and pathways, cover the body's external surfaces, and create some glands. As its name suggests, connective tissue holds the body's cells and organs together. Excited muscle tissue contracts strongly, causing movement.Additionally excitable, nervous tissue enables the formation and transmission of electrochemical signals in the form of nerve impulses that communicate between various bodily parts.

learn more about tissue here: https://brainly.com/question/427453

#SPJ2

The physician orders penicillin G procaine 400,000 units IM for syphilis. The medication is supplied in 1,200,000 units/2 mL. How many milliliters will the nurse administer?

Answers

Answer: 0.33ml

Explanation:

What you have: 1,200,000 units/2ml

What you need: 400,000 units/x

1,200,000/2ml   x 400,000/x =

400000/1,200,000 = 0.33ml

check answer: 0.33333333 x 1,200,000= 400,000 units

Other Questions
Read the quotation below from a high school science student.We used a formal method of study to figure out which kindof grocery bag had the least effect on the environment.What is the student describing?O A. Using scientific toolsB. Making random discoveriesC. Using the scientific methodD. Making a conclusion 3(5 + 6)=....................... A businessman wants to buy a truck. The dealer offers to sell the truck for either $120,000 now, or six yearly payments of $25,000.What is the interest rate being offered by the dealer in percentage (rounded to the closest integer number) 30 POINTS HELP Which idea was supported by Aristarchus, Copernicus, and Galileo?The planets have epicycles.The planets revolve around the Sun. The stars rotate around the Sun.The center of the solar system is Earth. The belief that Europeans are the superior class in society is called? Question 1 of 11What are two ways space exploration can improve international relations?DA By urging countries to compete to achieve goalsDB. By helping countries' economies grow weakerDC. By encouraging countries to share scientific dataDD. By inspiring countries to work together to solve problems explain the ides behind majority rule and minority rights 3. Study the changes in population graph, what % lived in cities by the 1930's?By the 1970's? What led the people of France to agree to an imperial dictatorship instead of a true democratic republic like the one selected in the American colonies? why human are not responsible for global warming? Which of the following cells can generate ATP through glycolysis? A. Eukaryotic Cells (Plants and Animals) B. Prokaryotic Cells (Bacteria) C. None of the above D. All of the above What is the length of EF in the right triangle below? Choose one of the three themes (social oppression, greed, or good vs. Evil) and explain something you know about it in the real world OR explain where else you have seen the theme (a book, movie, show, etc.) Please help quick What is f(2) if f(x) = 2x-5 and f(4) if f(x) = -3x + 15step by step please! Solve.Okay here is 20 letters brainy Please which one is the right answer Please help with this What is public participation? Why is itnecessary for environmental conservation AUUUAACUGUUCUGUCUAGAG1. Construct an Explanation Based only on the information provided, why could themRNA section be translated into three different sets of amino acids, instead of just oneset?2. Use Models Use the genetic code to translate the sequence into each of the threepossible sets of amino acids.3. Draw Conclusions Which of the three sets of amino acids is the most likely to beincluded in the polypeptide? Explain your reasoning. Please help me with this homework