PLEASE ANSWER ASAP!!!! How is Max able to feel this way after losing such a good friend, after losing half of Freak the Mighty? How is he able to be Mighty without Freak?

Answers

Answer 1

Answer:

He is able to because freak helped max gain confidence and become more independent.

Explanation:

Answer 2
Freak helped max become such a great person. He was able to build up confidence which is a great thing to have . Also he was able to have independence.

Related Questions

Read the excerpt from "Elevator Systems of the Eiffel Tower, 1889" by Robert M. Vogel.

The first complete elevator machine in the United States, constructed in 1855, was a complex and inefficient contrivance built around an oscillating-cylinder steam engine. The advantages of an elevator system independent of the mill drive quickly became apparent, and by 1860 improved steam elevator machines were being produced in some quantity, but almost exclusively for freight service. It is not clear when the first elevator was installed explicitly for passenger service, but it was probably in 1857, when Otis placed one in a store on Broadway at Broome Street in New York.

In the decade following the Civil War, tall buildings had just begun to emerge; and, although the skylines of the world’s great cities were still dominated by church spires, there was increasing activity in the development of elevator apparatus adapted to the transportation of people as well as of merchandise. Operators of hotels and stores gradually became aware of the commercial advantages to be gained by elevating their patrons even one or two floors above the ground, by machinery. The steam engine formed the foundation of the early elevator industry, but as building heights increased it was gradually replaced by hydraulic, and ultimately by electrical, systems.

Which sentence most directly supports the development of the central idea?

The first complete elevator machine in the United States, constructed in 1855, was a complex and inefficient contrivance built around an oscillating-cylinder steam engine.
It is not clear when the first elevator was installed explicitly for passenger service, but it was probably in 1857, when Otis placed one in a store on Broadway at Broome Street in New York.
In the decade following the Civil War, tall buildings had just begun to emerge; and, although the skylines of the world’s great cities were still dominated by church spires, there was increasing activity in the development of elevator apparatus adapted to the transportation of people as well as of merchandise.
Operators of hotels and stores gradually became aware of the commercial advantages to be gained by elevating their patrons even one or two floors above the ground, by machinery.

Answers

Answer:

I believe that the answer is C. In the decade following the Civil War, tall buildings had just begun to emerge; and, although the skylines of the world’s great cities were still dominated by church spires, there was increasing activity in the development of elevator apparatus adapted to the transportation of people as well as of merchandise.

Step-by-step explanation:

This is because, the whole text is about the elevator and its development throughout the years. This paragraph explains the development of the elevator, its possible purpose, and the time frame in which it took place. This sentence seems to sum up the text better than the other options.

Hope this helps! :)

The sentence most directly supports the development of the central idea is :

C. In the decade following the Civil War, tall buildings had just begun to emerge; and, although the skylines of the world’s great cities were still dominated by church spires, there was increasing activity in the development of elevator apparatus adapted to the transportation of people as well as of merchandise.

"Elevator Systems of the Eiffel Tower"

The sentence most directly supports the development of the central idea is in the decade following the Civil War, tall buildings had just begun to emerge; and, although the skylines of the world’s great cities were still dominated by church spires, there was increasing activity in the development of elevator apparatus adapted to the transportation of people as well as of merchandise.

This can be because, the full content is around the lift and its advancement all through the years.

This passage clarifies the advancement of the lift, its conceivable reason, and the time outline in which it took put.

Thus, the correct option is C.

Learn more about "Civil War":

https://brainly.com/question/14234520?referrer=searchResults

Which is the best definition of an allegory?

Answers

a story with a symbolic message.
C. a story with a symbolic message :)

Plz help I can not think of anything

1.
ASSIGNMENT:

Start with a brainstorming exercise. In the space provided, write at least THREE possible topics for your personal narrative. Write the topic and its theme, moral, or lesson for each.

Each topic MUST have an accompanying theme, moral, or lesson learned.

Answers

maybe one could be about a scary experience you had
Here are some things I thought of:

About a scary experience that made you learn something for the future

About moving to a different town, parents divorcing, or something interesting like that (make sure to include a lesson learned or something it taught you)

About something that happened to you as a child that effected you today.

Hope this helps <3

Evidence from “Cronus”


Explanation: How does this

evidence convey the theme?




PLZ NO TROLLING!!!! i need the right answer asap

Answers

the evidence from cronus conveys the theme by explanation of the evidence of the story cronus. evidence conveys cronus behavior in the explanation of that explained story.

youre welcome.

The answer is the one that gave you it

Jamari is doing a project on the levels of the rainforest. Which would be the most useful visual display to help make his information clear?

Answers

Answer:

I believe the answer is (B) The diagram with the levels of the rain forest labeled.

Explanation:

      The diagram will show all of the levels o the rain forest with facts and a visual look of each of them. Facts about ants or a picture of ants is not following the topic that much. It would only show one of the levels at the most not all of them. A video of you walking in the rain forest ifs not the best idea. Even if you do, you won't get all of the levels. I is about the levels of the rain forest. A map of where rain forests are would not help either. You know where the are, but you have not shown the levels if the rain forest. Only where rain forests are located.

Hope this helps!

The correct response is - The diagram with the levels of the rain forest identified, in my opinion, is the correct solution (B). The graphic will display information about each level of the rainforest, along with a visual representation of it. A list of ant facts or a picture of ants doesn't really follow the theme.

What is Rainforest?

A closed, continuous tree canopy, vegetation that depends on moisture, the presence of lianas and epiphytes, and the lack of wildfires are all characteristics of rainforests. There are several varieties of rainforests, including tropical rainforests and temperate rainforests.

At most, it would display one level, not all of them. It's not the finest idea to film yourself strolling through the rainforest. You won't complete all of the levels, even if you succeed. I'm talking about the rainforest's levels. Even a map showing the locations of rainforests would be useless. You are aware of their location, but you have not indicated their levels.

To read more about Rainforest, refer to - https://brainly.com/question/235998

#SPJ2

Help me please!! Thank you :)


An author's purpose may include______

Understanding the purpose or intention of the text usually involves understanding____________

Readers have to understand the author's point of view or________________

Knowing an author's point of view may__________________

Answers

Answer:

1. is to entertain, inform, or persuade hope this helps :)

Answer:

topic, persuade, entertain, inform,

perspective

hopes this helps

Nature is everywhere
Nature is everywhere you go
Everything that lives and grows
is nature
Animals
big and small
Nature is plants that grow so tall.
Nature is every way.
Wonderful. exciting
And need our care.
So listen, learn and do your part to keep nature
Beautiful forever.
Or you can destroy it and make nature a dangerous
place to live, animals and people are the same, they
have emotions, animals will feel abandoned from there
owners, and people have the same thing, they will swallowed
the sadness.
But if we help them, care for them alot, they will be happy for the
smallest thing you do to them.
I like this poem, hope you like it to.

Answers

Answer:

I like it!

Explanation:

Answer:

POINTS

Explanation:

EVERYONE LISTEN
I'm about to take a reading test and will be updating my questions every few minutes
the person who answers the most questions and gets me the best grade will get brainliest

Answers

Sounds good! I am in.

If I had time., I’ll be in too

What is one central idea in Martin Luther King Jr.'s "I Have A Dream" speech?

Selflessness means being willing to put the fight for justice above all else.

The dedication of the Founding Fathers has ensured justice for all people.

Nonviolence is an important tactic to use in the fight for justice.

The fight for justice requires being practical and logical.

Answers

Answer:

A or C

Explanation:

help pls give me the right answer thx giving brainlist .

Answers

Answer:

C or D

Explanation:

Answer:

Its D, "I don't like snakes."

Explanation:

Need helpp fastt plss will give brainliest to who is correct plss helpp
ITS MORE THAN ONE ANSWER BY THE WAY

Answers

simile and metaphor??
Personification and metaphor

PLS HELP
Read the excerpt from Martin Luther King Jr.'s "I Have a Dream" speech.

But one hundred years later, the Negro still is not free. One hundred years later, the life of the Negro is still sadly crippled by the manacles of segregation and the chains of discrimination.


How does King's allusion to the enslavement of African American people affect the speech?


It shows the listener that Dr. King is more interested in the history of African Americans than their present.


It reminds the listener of the horrible conditions of bondage and its aftereffects.


It explains why Dr. King thinks enslavement is bad.


It tells the listener that enslavement is illegal.

Answers

It explained why Dr. Kind thinks enslavement is bad.

I will make brainlist pls answer correctly and the text is down below DIRECTIONS: The following questions focus on the exposition, the rising action, and the falling action in
“Stray.” Answer each question in the space provided.
1. The exposition introduces the setting, characters, and basic situation. Here is one exposition detail:
Exposition detail: Snow has fallen.
What is another exposition detail?
Exposition detail:__________________________________________________________________________
__________________________________________________________________________________________
2. The events in the rising action come before the climax. There are many events in the rising action of “Stray.”
Here is one event in the rising action:
Rising action event: Doris meets the dog.
On the following lines, write two additional events that happen in the rising action.
Rising action events:
a. ________________________________________________________________________________________
b. _______________________________________________________________________________________
3. In “Stray,” the story winds up quickly after the climax. Here is one event in the falling action:
Falling action event: Mr. Lacey tells Doris he took the dog to the pound.
What is another event that happens in the falling action?
Falling action event:____

Answers

Answer:

i didnot understand but i i tring too help u .can u psss mark me brainlist

Explanation:

The Tell-Tale Heart

Poe's narrator insists he isn't mad, though his behavior suggests otherwise. Analyze how Poe uses the point of view of this “unreliable narrator” to create a feeling of horror. What does it show about the importance of character in a horror story or movie?

Answers

Answer:

Unreliable Narrator is the one who has his credibility compromised, either by lying or by presenting a questionable sanity. By telling lies, hiding information the narrator does not act in accordance with the narrative norms of the work. However, it is difficult to measure whether the reader really understands all the norms; after all, the narrator's contradiction can only be in opposition to the reader's understanding of that fictional world.

Thus, considering a narrative as unreliable can be configured as a kind of reader strategy that directs the narrator any and all interpretive discrepancies. Therefore, to question the credibility of the narrator it is also necessary to question the individual understanding of each reader.

The unreliable narrator's procedure contributes to the works maintaining the suspense character by narrating the actions inaccurately or incorrectly. The reader is waiting for when the narrator will be unmasked by any character or at what point in the plot will be evident that the sources used by the narrator are false or false.

Explanation:

The unreliable narrator creates a sense of horror by not allowing the viewer to gain a clear picture of what is really going on in the story. From the mans perspective, everything he does is justified which creates a certain mirage of what’s right and wrong.

CHARISMA: compelling attractiveness or charm that can inspire devotion in others. Write a paragraph using this word. PLEASE HELP!!

Answers

Answer:

The "grace of truth" (the charisma), which the apostles had called down upon their first disciples by prayer and laying on of hands, and which was to be imparted anew by way of succession  to the bishops from generation to generation without a break, makes those who receive it living witnesses of the salvation offered to the faithful by written and spoken tradition.

Explanation:

Answer:hi

Explanation:cool

True and False: When a dependent clause comes at the start of a complex sentence, you need to a comma after it.
hurry pls help

Answers

Answer:yes

Explanation:

 

True and False: When a dependent clause comes at the start of a complex sentence, you need to a comma after it.
hurry pls help


ANSWER: True

ONLY ANSWER IF U KOW THE ANSWER
Poe is the master at creating a scary and suspenseful mood in his stories. Can you find two different parts in the story where Poe is specifically creating this type of mood? ( The Cask of Amontillado)

Answers


Kakskskwkskskskskkskwkww

Use context to determine the meaning of the word dissemble as it is used in The Tell-Tale Heart. Write your definition of dissemble here and explain how you figured it out.
“Villains!” I shrieked, “dissemble no more! I admit the deed!— tear up the planks!—here, here!—it is the beating of his hideous heart!”

Answers

Dissemble means conceal one's true motives, feelings, or beliefs.

In the context of "The Tell-Tale Heart," the word "dissemble" means to conceal or hide one's true feelings, motives, or intentions.

From the given passage, the narrator is addressing the villains, urging them to stop pretending or disguising their actions. The narrator implores the villains to acknowledge the truth, confessing to the murder they committed.

The use of the word "dissemble" suggests that the villains have been pretending or deceiving others about their involvement in the crime. By examining the narrator's plea and the overall tone of the passage, we can infer the meaning of "dissemble" in this specific context.

Learn more about The Tell-Tale Heart here

https://brainly.com/question/28518251

#SPJ6

need help pls someone
brainly offerd!!

Answers

The answer would be C.
The answer is realistically C:)

Read the excerpt from The Diary of Anne Frank and answer the question that follows.

Mrs. Frank. You know how young people like to feel that they have secrets. Peter’s room is the only place where they can talk.

Mrs. Van Daan. Talk! That’s not what they called it when I was young.

[MRS. VAN DAAN goes off to the bathroom. MARGOT settles down to read her book. MR. FRANK puts his papers away and brings a chess game to the center table. He and MRS. FRANK start to play. In PETER’s room, ANNE speaks to PETER, indignant, humiliated.]

Anne. Aren’t they awful? Aren’t they impossible? Treating us as if we were still in the nursery.

What is the meaning of the word indignant in this passage?

pleased
confused
sympathetic
exasperated

Answers

Answer:

a or b are my guesses

Explanation:

answer:

A or Pleased

Explanation:

i checked it

What is the connection between the sections "A source of life" and "Protected from invaders"?

A
Both sections describe how the landscape contributed to the development of ancient Egyptian civilization.
B
Both sections outline why the Nile River was essential to the development of ancient Egyptian civilization.
C
Both sections explain how ancient Egyptian civilization affected the Nile River and the surrounding environment.
D
Both sections provide evidence to show that ancient Egyptian civilization was not affected by the desert landscape.


ITS FROM NEWSELA!

Answers

The answers B ccuucuvuxuxt

Both sections outline why the Nile River was essential to the development of ancient Egyptian civilization. So, option B.

What is meant by civilization ?

A civilization is a multifaceted human society with varying degrees of cultural and technological advancement.

The Nile River's annual flooding provided stable, fertile soil for crop cultivation, which was a major factor in the development of Egyptian civilization along its banks.

The significance of Egypt's agricultural output and economic resources was demonstrated by the region's repeated struggles for political control.

One of the world's most well-known rivers is the Nile. The Nile Stream Valley was crucial to the progress of a few old civilizations. Despite the harsh desert climate that surrounded them, the earliest civilizations were able to thrive due to the Nile River.

The Nile River Valley includes not only the river itself but also the lowlands and banks that surround it and benefit from flooding.

Ten percent of the land in Africa is in the Nile River Valley. Over 250 million people live in the river valley, and their survival depends on the Nile River's resources.

Hence,

Both sections outline why the Nile River was essential to the development of ancient Egyptian civilization. So, option B.

To learn more about civilization, click:

https://brainly.com/question/29774484

#SPJ3

HELP ME! this is real important

Answers

The meaning of the word dispute means a form of an argument.

Answer:

The meaning of the word dispute means a form of an argument.

Explanation:

Which organizational pattern does the passage follow?

description
chronological
cause and effect
problem and solution

Answers

Answer:

.................,................

Cause And Effect

..................................

Chronological is the pattern

Please identify THREE author techniques used by your author (can be from the novel and/or the short stories that you read), and provide a quote from the book that supports each technique. Once identified, please explain the author’s goal for using each one. You will write this out in paragraph form and submit a typed copy to the teacher.

Did you include:
____ 3 author techniques
____ 3 quotes that support each technique
____ 3 goals (one for each technique)

Answers

Answer:

you have to give us what ur reading you know

Explanation:

1. alphabetical list of important terms, along with the
definitions and pronunciations of the terms; located
near the end of the book.
2. an alphabetical list of topics in the book with the page
numbers; located near the end of the book.
3. a list of the major parts of a book and the starting page numbers; located at the front of a book.

Part II- “Print” Terms:

4. text printed darker or in color to make words stand out.
5. a style of print with the letters slant to the right.
6. the type and size of the text.
7. the title of the text.
8. the title of a section of the text.
9. symbols used to emphasize a list of items.
10. additional information at the bottom of the page;
usually the definition of an unfamiliar word in the main text.
11. words used to explain what is shown in a picture;
these words are located above, beneath, or beside the picture.

Part III- “Graphic” Terms:

12. a chart that shows and explains the steps in a process or cycle.
13. a graphic used to show events in chronological order.
14. a drawing that has all the parts of the object labeled.
15. a representation of the earth’s surface or the location of a place.
16. a chart divided into rows and columns, containing numbers and words.
17. related information in a box or in the margin to the side of the main text.
18. displays numerical information & often compares things in a visual way.
19. a visual image (picture) taken with a camera.
20. a visual image (picture) created by sketching or drawing.

word bank:
1. illustration
2. photograph
3. sidebar
4. table of contents
5. heading
6. index
7. subheading
8. glossary
9. bold
10. map
11. italic
12. diagram
13. font
14. bullets
15. caption
16. timeline
17. graph
18. footnote
19. table
20. flowchart

Answers

Okay so matching the words to the definition am I correct let me know so I can help I just wanna make sure

Read and type at least 4 sentences.

Answers

Answer:

The author supports the Panama Canal as a phenomenon by explaining the historical circumstances that led to the making of this phenomeonon. However, even though there was conflict during the making of the Canal, there were solutions that helped us to get around such conflict. For example, when France began the construction of the canal in 1879, there was the conflict of inclement weather and a decrease in workers, primarily due to illness. In response, America decided to take over the project for France.

Read the last paragraph of the story again. Do you think Montresor feels any regret for killing Fortunato in the story?

Answers

Answer:

Yes, i believe he does.

Explanation:

ONLY ANSWER IF U KNOW THE ANSWER
what is the main conflict in tell-tale heart

Answers

Hi! I have just read this in English class and think that I can answer your question. The main conflict in the story the fact that the narrator kills a man simply because of his freaky eye. It is a man vs. self conflict.

Have a great day!

Answer:

"The major conflict in the story is that the narrator kills the old man simply because he dislikes the look of his eye. The  conflict is a person vs. self conflict because the the old man hasn't done anything on purpose to upset the narrator. The conflict is all in the narrator's head."

Explanation:

Hope it helps

Read this passage about Amelia Earhart.

Amelia Earhart was born July 24, 1897, in Kansas. She was an adventurous and fun-loving child. That adventurous spirit remained as she grew older. One day in 1920, after going on a plane ride, she was determined to fly planes. She worked at any job she could find to save up for flying lessons, which cost $1,000. At one point, she worked as a nurse’s aid and a social worker. Six months after receiving flying lessons, Amelia bought her own plane, and she flew as high as 14,000 feet, which set a world record for female pilots. A short time afterward, Amelia became the sixteenth female to earn a pilot’s license. In 1928, an opportunity arose for Amelia to participate in a transatlantic flight across the Atlantic Ocean as a copilot. This experience later came in handy when she became the first woman to fly solo across the Atlantic in 1938. She received many honors for this achievement, such as the Distinguished Flying Cross from Congress.

As Amelia approached her fortieth birthday, she was planning her biggest trip yet: She wanted to be the first woman to fly around the world. Of course, she needed a lot of help to make this happen. She made a first attempt that failed and damaged her plane. But Earhart was not one to give up, so she made another attempt at the ground-breaking mission. She did make some progress by flying 7,000 miles to New Guinea but did not make it to her next stop, Howland Island. Sadly, Earhart’s plane disappeared, and, despite search and rescue attempts, she was never found. To this day, Earhart is known and celebrated for her bravery, persistence, and commitment to aviation.

Which additional information would be most appropriate for a student to include in a yearbook page about Amelia Earhart?

A. In 1928, an opportunity arose for Amelia to participate in a transatlantic flight across the Atlantic Ocean as a copilot.
B. One day in 1920, after going on a plane ride, she was determined to fly planes.
C. But Earhart was not one to give up, so she made another attempt at the ground-breaking mission.
D. This experience later came in handy when she became the first woman to fly solo across the Atlantic in 1938.

Answers

Answer:

B

Explanation:

The answer is B

Answer:

I believe it is C.

"Am I addressing the White Queen?"

"Well, yes, if you call that a-dressing," the Queen said. "It isn't MY notion of the thing, at all."

. . . "If your Majesty will only tell me the right way to begin, I'll do it as well as I can."

"But I don't want it done at all!" groaned the poor Queen. "I've been a-dressing myself for the last two hours."

It would have been all the better, as it seemed to Alice, if she had got some one else to dress her, she was so dreadfully untidy.

—Through the Looking Glass,
Lewis Carroll

When Alice uses "addressing," she means.
a.talking to
b.getting dressed
c.writing out envelopes
When the Queen says "a-dressing," she means
a.talking to
b.getting dressed
c.writing out envelopes

Answers

Answer:

A. Talking to

The second question will be B.Dressing

Explanation: I say A because when you addressing to someone you are telling them something or explaining something someone. I hope this is the right answer <3

The queen thinks alice means dressing as in dressing up for a occasion.

Talking to
The reason being because when you address something or someone you are either talking to or naming them. For example hello your majesty
Other Questions
what were the political limitations of african american during 1865-1900? one paragraph the sunshine Club collected 524 cans for a canned food drive. the cans were then split up equally into 8 boxes. Part A how many can were in each box? Part B how many can were left over after the boxes were filled? Helppp plzz!! A.) Side - Side - SideB.) Side - Angle - SideC.) Angle - Side - AngleD.) Angle - Angle - SideE.) Hypotenuse - LegF.) Not enough information. my picture please hahahahahahah Read the excerpt from The Dark Game: True Spy Stories from Invisible Ink to CIA Moles.Tension between the two sides escalated until June 1948, when the Soviets blocked all western access to the capital. In this first real crisis of the Cold War, the West was not going to be denied by the Soviets.If the underlined word were replaced with the word "event, the tone of the excerpt would bemore resentful.more intellectual.less intense.less objective. how might have the oppressive British rule influenced the ideas of the articles of confederation ? A collection of the same kind of cells working together to do the same job HELP PLEASE ASAP Read the excerpt from "On Becoming an Inventor" by Dean Kamen.When I was twelve years old and Barton, my older brother, was around fifteen, we took over the family basement. At first, I made a darkroom for developing pictures, and Bart was using it as his lab where he was raising about one hundred white rats, removing their thymus glands, and trying to figure out the glands' dysfunction. He wanted pictures taken of his experiment, doing the surgery on rats, and since I already had a darkroom, I took the pictures, though somewhat reluctantly. I didn't like the blood.What can you conclude about Barton from the excerpt?He was interested in solving medical mysteries at a rather early age.He did not understand why Dean would be squeamish about the blood.He went on to become a very famous and successful doctor.He had a severe dislike for rats and all other kinds of rodents. find the slope of the line passing through the points (-5,5) and (-5,-8) What is the unit rate of 232 people in 8 classrooms? i need help with this pleasee five men build a wall in 10 days how long will it take 10 men Anchara drops a penny from a height of 60 feet above the ground. The equation h=-16t^2 + 60 models the penbys height h i feet as a function of time t in seconds whatvare the solutions P3- is a(n) ______________________, so it ________________ valence electrons. Group of answ er choices anion, gained cation, gained cation, lost anion, lost The following DNA is being replicated and the origin of replication is in the middle of the sequence and marked with three stars ***. 5'ATCGGGCTACCCATGAAATGCTAGCATT***TAAGATCTTAAGCTAGCTAGTTCGATCTGA3'What is the sequence of the primer for the LEADING strand? Your answer should be 8 nucleotides long, written from 5' to 3' and only include the nucleic acid sequence (ex: ACTACTAC).note: there are two answers for this question A farmer's market is selling peaches for $2.00 a pound. If you buy 2 pounds, you save 10% on each pound. How much does it cost to get 2 pounds of peaches? 1. What right do education encompasses both entitlements and freedom?A. Right to free and compulsory primary educationB. Right the quality education in private schoolC. Right to choose yourteachersD. All of the above2. Which of the following is an example of non-formal education?A. Primary schoolingB. Senior high schoolC. Adult night classesD. Doctorate program El libro. _____ Libros. Approximately how many people are likely trafficked into the United States each year?5,5008,5008,50011,50011,500-14,500O 14,50017,500 She dove 75 feet under the sea