solve the equation, due today !!

Solve The Equation, Due Today !!

Answers

Answer 1
2x^2 + 32 = 0. |:2 - divide it by 2
x^2+16=0
x^2=-16
х not belong R


Related Questions

Laura checked her outdoor thermometer and noticed that the temperature rose from 31 degrees in the morning to 45 degrees in the afternoon. What is the approximate percent increase for the day so far?

A. The percent increase is approximately 31%.

B. The percent increase is approximately 45%.

C. The percent increase is approximately 68%.

D. The percent increase is approximately 82%.

Answers

Answer:

C

Step-by-step explanation:

If you  find the difference between 45 and 31, you find the increase. Take that and make it a percentage of 68. I hope this helped! Have a great day.

after scoring a touchdown the billies linked up for the kickoff . the kicker kicked the football 60 yards deep into the end zone. the hang time on the ball was 8.5 seconds . what was the average speed of the ball​

Answers

Answer:

7 seconds i think let me know if its wrong

Step-by-step explanation:

Kelly solved an equation: H/ 4 - 11 = 13 using two inverse operations of adding 11 to both sides of the equations, and then dividing both sides by 4. Her answer is H = 6. What is her error?

Answers

Answer:

She should have multiplied by 4, not divided

Step-by-step explanation:

Given

[tex]\frac{H}{4}[/tex] - 11 = 13 ( add 11 to both sides ) ← correct

[tex]\frac{H}{4}[/tex] = 24 ( multiply both sides by 4 to clear the fraction )

H = 4 × 24 = 96

H is divided by 4, thus the inverse operation is to multiply

96.90+2.04-24.30 Round your answer to the nearest second decimal

Answers

Answer:

74.64

Step-by-step explanation:

hope this helps :)

Answer:

74.60

Step-by-step explanation:

Hope this helps!

Starting from home john rides his bike to school and then to the library. How far, in kilometers does John ride his bike? home (1 -3) school (-1, 2) library (3, 2)

Answers

Answer:

9.385 km

Step-by-step explanation:

Given the points :

home (1 -3) school (-1, 2) library (3, 2)

Distance between Home and school :

Distance = √(x2 - x1)² + (y2 - y1)²

Home = (1, - 3) ; School = (-1, 2)

x1 = 1 ; y1 = - 3 ; x2 = - 1 ; y2 = 2

Distance = √(-1 - 1)² + (2 - (-3))²

Distance = √-2² + 5²

Distance = √4 + 25

= 5.385 km

From school to library :

School = (-1, 2) ; library (3, 2)

x1 = - 1 ; y1 = 2 ; x2 = 3 ; y2 = 2

Distance = √(x2 - x1)² + (y2 - y1)²

Distance = √(3 - (-1))² + (2 - 2)²

Distance = √4² + 0²

Distance = √16 + 0

Distance = √16

Distance = 4 km

Total distance in kilometers from home to library :

(5.385 + 4) km = 9.385km

Why is the product of negative reciprocals always -1?

Answers

Answer:

please check the explanation.

Step-by-step explanation:

Let suppose we have a number = n  

n≠0    

The negative reciprocal of 'n' = -1/n

Taking the product of 'n' and its negative reciprocal '-1/n':

[tex]n\left(-\frac{1}{n}\right)[/tex]

remove parentheses: (-a) = -a

[tex]=-n\frac{1}{n}[/tex]

[tex]\mathrm{Multiply\:fractions}:\quad \:a\times \frac{b}{c}=\frac{a\:\times \:b}{c}[/tex]

[tex]=-\frac{1\times \:n}{n}[/tex]

[tex]\mathrm{Cancel\:the\:common\:factor:}\:n[/tex]

[tex]=-1[/tex]

Canceling the common factor (the number itself) will bring -1.

It proves that the multiplication of any number and its negative reciprocal will always yield -1.

A rain gauge had 0.6 centimeter of rain after 2 hours, 0.9 centimeter after 3 hours, 1.2 centimeters after 4 hours, and 1.5 centimeters after 5 hours. At what rate (cm per hour) did it rain?

Answers

Answer: 0.3 cm per hour

Step-by-step explanation:

got it off of quizizzes

Solve for x and then find the measure of angle, A.

Answers

Answer:

x = 8

The measure of angle A = 30°

Step-by-step explanation:

angle A and B are supplementary and their sum is 180°

6x - 18 + 14x + 38 = 180° add like terms

20x + 20 = 180

20x = 180 - 20

20x = 160 divide both sides by 20

x = 8 and the measure of angle A

6x - 18 ➡ 6 × 8 - 18 = 30°

I need the answer please!!!!!!!



Solve: -2(x+4)-1=3(x-2)+4

Answers

Answer: x= -7/5 procedure: -2x-8-1=3x-6+4       -2x-9=3x-2   -2x-3x= -2+9    -5x= 7   answer: x= -7/5

Please help need answer now!!

Answers

Answer: 5/2

Step-by-step explanation:

Using slope formula m = rise/run

At a basketball game 64% were supporting the visiting team. If total number of people attending h the e game was 2000, how many people were supporters of the home team

Answers

Answer:

720

Step-by-step explanation:

0.64 x 2000 = 1280

2000 - 1280 = 720

No. of people supporting the home team out of 2000 people is 720.

What is the percentage?

A percentage is a value per hundredth. Percentages can be converted into decimals and fractions by dividing the percentage value by a hundred.

Given, At a basketball game, 64% were supporting the visiting team.

The percentage of people supporting the home team is

(100 - 64)% = 36%.

Now, Total number of people who came to watch is 2000.

∴ No. people supporting the home team is,

= (36/100)×2000.

= 36×20.

= 720 people.

learn more about percentages here :

https://brainly.com/question/24159063

#SPJ2

1. Ginger has 31 drinking straws. If each
straw is 7.875 inches long, how long are
the straws altogether?

Answers

31 x 7.875 = 244.125

244.125 inches altogether

What graph represents the equation y = -1/2x + 1?

Answers

Answer:

The answer to your question is A.

Step-by-step explanation:

What is the range of the function graphed below?

Answers

The range is all possible y values. In this function, range is from -3 < y
* the

Write a quadratic equation in standard form with the given roots. Show your work to find the equation. -6, 5/2

Answers

Answer:

x^2 + 7/2 + 15 is the answer.

Step-by-step explanation:

Make the number that is equal to x be on the side of the x, then multiply those to values.

x = -6

x= 5/2

(x + 6)*(x - 5/2)

Now, distribute the x to the x and the negative 5/2, and add that to 6 distributed to x and negative 5/2. Simplify.

[tex]x^{2} + -\frac{5}{2}x + 6x + 15\\\\x^{2} + \frac{7}{2} + 15[/tex]

#teamtrees #WAP (Water And Plant)

A public swimming pool that holds 45,000 gallons of water is going to be drained for maintenance at a rate of 100 gallons per minute. The amount of water w (in gallons) in the pool after t minutes is given by the function w = 45,000 - 100t. Graph the function. Identify its domain and range. How much water is in the pool after 60 minutes? How many minutes will it take to empty the pool?

Answers

Answer: for the first question, after an hour there would be 39,000 gallons left and it would take 450 minutes to drain the pool

Step-by-step explanation:

You multiple the minutes with the rate or which the gallons are being drained and subtract it by the total amount,

Ps can I get the brainliest answer

We want to get the domain and range, graph, and analyze the given function.

We have the function:

w(t) = 45,000 - 100*t.

First, we want to get the domain and range of the function.

The domain is defined as the possible values of the input, in this case, is the time.

The smallest value of the time is t = 0, and the largest is the value of t such that the pool is empty, so we need to solve:

w(t) = 0 = 45,000 - 100*t

t = 45,000/100 = 450

Then the domain is D = [0, 450]

The range is the set of the possible outputs, the output represents the amount of water in the pool, it goes from full to empty, so the range is:

R = [0, 45,000]

The graph of the function can be seen below.

How much water is in the pool after 60 minutes?

Just replace t by 60 in the equation.

w(60) = 45,000 - 100*60 = 39,000

This is 39,000 gallons of water.

How many minutes will it take to empty the pool?

We already found that it takes 450 minutes.

If you want to learn more, you can read:

https://brainly.com/question/2263981

Please help!!!!!!!!!​

Answers

Answer:

8/125

Step-by-step explanation:

PLZ ANSWER FIRST GETS BRAINLIEST + 20 POINTS

Answers

Answer:

x= -2, y = 5

Step-by-step explanation:

y = -4x-3

y = -2x+1

Set the two equations equal to each other

-4x-3 = -2x+1

Add 4x to each side

-4x-3 +4x = -2x+1+4x

-3 = 2x+1

Subtract 1 from each side

-3-1 = 2x+1-1

-4 =2x

Divide by 2

-4/2 = 2x/2

-2 =x

Now find y

y = -4x-3

y = -4(-2) -3

y = 8 -3

y =5

A. -2
B. -1/2
C. 1/2
D. 2

Answers

The correct answer is C

2x4^7=
What is 2x4^7
Example: 2x5^7=2x=78,125

Answers

the answer is 32,768. Do the problem same as your example.

help im being timed what is the perimeter of this triangle?!

Answers

Answer:

AB + BC + CA

Step-by-step explanation:

12b-8 + 12b- 8 + 9b+8

33b - 8

To find the PERIMETER of a triangle, add the length of its sides.EXAMPLE ⇒ If a triangle has sides a, b, and c, then the perimeter of that triangle will be P = a + b + c. NOTE: The P stands for PERIMETERHope this helpsGod bless

Write the equation of the line that passes through the
point (6,4) and is parallel to 2x + 3y = 18.

Answers

Parallel = same slope
Find slope of 2x + 3y = 18
Start by putting it in y = mx+b form
Y = -2/3x + 18
Slope is -2/3x
Y = -2/3x + b
Plug in the points into equation
4 = -2/3(6) + b
4 = -4 + b
b = 8
Equation: y = -2/3x + 8

The equation of the line that passes through the point (6,4) and is parallel to 2x + 3y = 18 is: y = -2/3x + 8

What is an equation?

An equation is an expression that shows the relationship between two or more numbers and variables.

Given that line passes throuthe gh the point (6,4) and is parallel to 2x + 3y = 18.

Parallel lines have the same slope

To Find slope of 2x + 3y = 18

Then Start by putting it in y = mx+b form;

Y = -2/3x + 18

Slope = -2/3x

Y = -2/3x + b

Now Plug in the points into equation

4 = -2/3(6) + b

4 = -4 + b

b = 8

Hence, the Equation: y = -2/3x + 8

Learn more about equations here;

https://brainly.com/question/25180086

#SPJ2

Write this ratio as a fraction in simplest form
140 centimeters to 300 centimeters
Answer choices:
A. 14/30
B. 4/7
C. 1/3
D. 7/15

Answers

Answer:

D

140/300 simplifies to 14/30 and that can be simplified even more to 7/15

Which situation could NOT represent a proportional relationship?

A: The number of gallons of water in x barrel with 42 gallons of water in each barrel

B: The amount an employee who makes $8.50 per hour in h hours

C: The weight in x weeks of a puppy that gains 2 pounds per week if it's starting weight is 8 pounds

D: The cost of purchasing p pounds of bananas for $0.55 per pound​

Answers

Answer:

the answer is B

Step-by-step explanation:

pay attention to the word NOT

Tom has $5.05 in quarters and dimes. How many coins are quarters if the total
number of coins is 28? Try creating a system of equations and solving this by either
substitution or elimination.
quarters

Help due by 8 am tm

Answers

Answer: The answer would be 7.03

Step-by-step explanation: cause you gotta get the 28 in there i hope im right

Answer:

15 quarters

Step-by-step explanation:

Assuming q = quarters and d = dimes...

First, set up the equations. q + d = 28 since we have 28 coins, and the latter is because a quarter is worth $0.25 and a dime is worth $0.1 - totaling $5.05.

q + d = 28

.25q + .10d = 5.05

Try to get one of the variables equal to the equation above. In this case, I tried to get the "q" variables equal to each other.

q + d = 28

4(.25q + .10d) = 4(5.05)

After this, you "subtract" the two equations from each other. Remember that d = 1d, and 1 - .4 = .6

q + d = 28

q + .4d = 20.20

Divide both sides by .6 to get d by itself.

.6d = 7.8

There are 13 dimes.

d = 13

Subtract 13 from the total coins (28) to get the amount of quarters.

28 - 13 = 15

13 dimes, 15 quarters. Hope this helped!

Help me please I will give you the brainliest please ;( :[​

Answers

Answer:

I'm not great with domain and range but for the 4th question the answer is b. and for the 5th part 1 the answer is a. and for part 2 the answer is d. i believe

Every term is

a constant

a variable

an expression​

Answers

An expression nahehshddsjshshs
A variable since the coefficients wouldn’t match with others.

What is the value of x?

Answers

Answer:

x = 5[tex]\sqrt{7}[/tex]

Step-by-step explanation:

Using Pythagoras' identity in the right triangle.

The square on the hypotenuse is equal to the sum of the squares on the other 2 sides, that is

x² + 9² = 16²

x² + 81 = 256 ( subtract 81 from both sides )

x² = 175 ( take the square root of both sides )

x = [tex]\sqrt{175}[/tex] = 5[tex]\sqrt{7}[/tex] ≈ 13.23 units ( to 2 dec. places )

Answer:

x = 5√7

Step-by-step explanation:

By pythagoras theorem,

(hypotenuse)² = (altitude)² + (base)²

(hyp)² - (base)² = (alt)²

(16)² - (9)² = x²

256 - 81 = x²

x² = 175

x = √175

x = 5√7

hope this helps you!

(HELP ME PLEASE) In a triangle that two of its sides are worth 8 cm and 10 cm, the possible values ​​of the third side are:

Answers

Answer:

I'm not sure....

10-8 = 2

lowest point

10+8 = 18

highest point

so the possible values of the third side are:-

3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17

I'm not sure this is what you are looking for but this is my answer....

i hope this helps...

have a great day ahead :)

I need the answer for all but the last one.

Answers

Answer:

2. 7 + 4

3. 21 - 27

4. 8 - 28

Step-by-step explanation:

2. 1 (7+4) = 1×7 + 1×4 = 7 + 4

3. 3 (7-9) = 3×7 - 3×9 = 21 - 27

4. 4 (2-7) = 4×2 - 4×7 = 8 - 28

hope this helps :)

Answer:

1. the answer is 7+4

2. the answer is 21-9.

3. the answer is 8-7.

Hope this helps, have a great day/night, and stay safe!

Other Questions
A collection of the same kind of cells working together to do the same job HELP PLEASE ASAP Read the excerpt from "On Becoming an Inventor" by Dean Kamen.When I was twelve years old and Barton, my older brother, was around fifteen, we took over the family basement. At first, I made a darkroom for developing pictures, and Bart was using it as his lab where he was raising about one hundred white rats, removing their thymus glands, and trying to figure out the glands' dysfunction. He wanted pictures taken of his experiment, doing the surgery on rats, and since I already had a darkroom, I took the pictures, though somewhat reluctantly. I didn't like the blood.What can you conclude about Barton from the excerpt?He was interested in solving medical mysteries at a rather early age.He did not understand why Dean would be squeamish about the blood.He went on to become a very famous and successful doctor.He had a severe dislike for rats and all other kinds of rodents. find the slope of the line passing through the points (-5,5) and (-5,-8) What is the unit rate of 232 people in 8 classrooms? i need help with this pleasee five men build a wall in 10 days how long will it take 10 men Anchara drops a penny from a height of 60 feet above the ground. The equation h=-16t^2 + 60 models the penbys height h i feet as a function of time t in seconds whatvare the solutions P3- is a(n) ______________________, so it ________________ valence electrons. Group of answ er choices anion, gained cation, gained cation, lost anion, lost The following DNA is being replicated and the origin of replication is in the middle of the sequence and marked with three stars ***. 5'ATCGGGCTACCCATGAAATGCTAGCATT***TAAGATCTTAAGCTAGCTAGTTCGATCTGA3'What is the sequence of the primer for the LEADING strand? Your answer should be 8 nucleotides long, written from 5' to 3' and only include the nucleic acid sequence (ex: ACTACTAC).note: there are two answers for this question A farmer's market is selling peaches for $2.00 a pound. If you buy 2 pounds, you save 10% on each pound. How much does it cost to get 2 pounds of peaches? 1. What right do education encompasses both entitlements and freedom?A. Right to free and compulsory primary educationB. Right the quality education in private schoolC. Right to choose yourteachersD. All of the above2. Which of the following is an example of non-formal education?A. Primary schoolingB. Senior high schoolC. Adult night classesD. Doctorate program El libro. _____ Libros. Approximately how many people are likely trafficked into the United States each year?5,5008,5008,50011,50011,500-14,500O 14,50017,500 She dove 75 feet under the sea To be eligible for Bright Futures, you must submit a statement explaining how all money will be repaid submit a plan of action for all courses throughout college take at least three remedial credits in the first semester take at least six non-remedial credits per semesterplease only answer if you know what your talking aboutand if your right i will give brainiest. What was the biggest drawback of Chinese block printing? In a perfectly insulated container of negligible mass, 4.00 102 kg of steam at 100C and atmospheric pressure is added to 0.200 kg of water at 50.0C. A) If no heat is lost to the surroundings, what is the final temperature of the system? B) At the final temperature, how many kilograms are there of steam and how many of liquid water? What is the importance of the Battle of Khanua and Chaunsa? VocabularyMake a sentence using these two wordsdedicated, obstaclecollaborate, techniques 3) Complete the sentences. Use the Past Simple or the Present Perfect Simple form of the verbs in brackets1 Marry_____(win) the lottery last year.2 I _____(not see) anyone yet.(come/just) home.4. They____(buy) the car two years ago5. William still____(not buy) the present for his sister 4 Complete the sentences. Use the Present Perfect Simple or the Present Perfect Continuous form of the verbs inbracts1. The baby's face is really dirty. What____(he/eat)?2. Like____(never/be) abroad3. Eva is exhausted these days. She______(work) too hard recently.4.______(you/finish) your homework yet?5. I_____(clean) all morning I'm really tired!