Spanish Middle School

Using the chart below select which word completes the sentence:



¿______ regresas a casa?

Question 5 options:

Cuándo


Cómo


De dónde

Answers

Answer 1
Answer is “cuando”
¿ Cuando regresas a casa?
______
Answer 2

Answer:

Cuándo

Explanation:

"When will you get home?"

Related Questions

Lee la situación y el diálogo. Después, escoge la mejor expresión para completar la conversación. Read the situation and the dialogue. Then select the best expression to complete the conversation.

Two co-workers meet for the first time.
—¡Hola! Yo soy la señora López. ¿Cómo se llama usted?
—¡Buenos días! Yo me llamo señora Carmina.
—Mucho gusto.
—________.

Based on the information provided, what would be a possible response from señora Carmina?

Muy mal
Más o menos
Encantado
Igualmente
I feel like its Encantado but idkk

Answers

Answer:

I would said it's between Igualmente and encantado

BUT since López said Mucho gusto then it will make more sence with  Igualmente.

But if it was es un placer de conocerla then it will be encantado.

The answer is igualmente

another way to say hacer un download is___

Answers

Answer:

Descargar I believe

Explanation:

I'm just guessing here

Answer: Descagar & Bajar

What is a “turn” program? Explain how it works. please help

Answers

Answer:

The Turn is a nonprofit organization in Northeast Ohio dedicated to improving the health and wellness of people with physical disabilities, free of charge, through innovative programs combining functional fitness training and adaptive recreation.

Explanation:

Hope This Helps!

a turn profit is a non profit organization

What is the best free site to learn Spanish grammar?

Answers

Duo lingo is a pretty good app
Google said this is a good one to use Busuu :))

Empareja cada frase con el tipo de error o errores que ves en cada una. Match each sentence with the type of error or errors you see in each.

¡El dia 14 de mayo es tu quinceañera! Tienes la fiesta el dia 14 de mayo. La quinceañera es una fiesta bonita.
Me yamo Erica. Soy alta y bonita. Hoy estoy muy bien.
La fiesta de Rosa y Javier es el trece de Septiembre. Es el Jueves. Tengo la dirección de correo electrónico de Rosa, pero no tengo la dirección de Javier
Yo tengo el pelo castaño y soy baja. ¿Cómo erres? ¿Erres alta o baja, rubia o pelirroja?

A) Word with incorrect alphabet letter
B) Unnecessary capitalization
C) Word missing accent mark
D) Misspelled words
Basically match them like A goes with which spanish sentence and B goes for which and the same for the rest, you have to match them with the errors!

Answers

Lol I wanted to help but still don’t know Spanish like that and I’m in Spanish 2 smh
A.)”Erres ‘alta’ o baja...” alta should be “altas” B.) “septiembre” and “jueves” don’t have to be in capital letters C.) “dia” should be “día” D.) “Me yamo Erica” it should be “Me llamo Erica”

Adivina la palabra


_ _ _ _ _ _ _ _ _ _ _ _

es como algo (ejemplo: un buen día)

una pista: es de disfrutar en familia

Answers

Answer:

Thanksgiving/Acción de gracias

Explanation:

es como algo (ejemplo: un buen día)

una pista: es de disfrutar en familia

it's like something (example: a good day)

a hint: it is to enjoy as a family

Puede ser Día de gracias (thanks giving)

In order to type an email what part of the computer do you use?

Answers

Answer:

el teclado

Explanation:

El teclado is used in order to send an email through the computer

What are the two systems to tell time in spanish?



Explain how to use the 24-hour clock.


type the answers in english please

Answers

Answer:

wdym by english

Explanation:

What are you trying to say

What is educación técnica? Is there another nombre para este tipo de educación?

please put the answer is english <3

Answers

education and name!                                

Answer:

education and name

Explanation:

education and name

Will give brainlist !!!!!!!!!!

Answers

Answer:

7 in the morning its 7 in the morning

Answer:

o seven in the morning.

(La clase de inglés inicia a las siete de la mañana).

Hey guys! I will give Brainliest to the best answer. Please do not answer with something that is totally unhelpful or unintelligent. Please choose one of the provided answers, thanks) :))
Hope you have a good day!
(I think the answer is C, but I wanna be 100% sure)

Answers

i agree with your answer. C looks to be the most accurate one given.
i do spanish in school and i think is C too(hopefully im right)

Translate the text in the following picture:

First to answer gets brainliest.

Answers

hello friend!
how are you? i am good, here are some activities i like
i like to dance, i dance all kinds of music especially salsa, cumbias and merengues. i like to sing too, i like romantic song but i like marachi music too. i like to play the guitar and piano. what about you ?
i am nervous now because i need to study for mathematics exam. i have to study now.
until later
hello friend!
how are you? i’m good, here are some activities i like doing.
i like to dance, i dance all type of music especially cumbia, salsa, and merengue. I also like to sing. I like singing romantic but also mariachi. I play guitar and piano.
What do you like doing?
Now i’m nervous because i have to study for my test of mathematics, I have to go study.

Till later,
Xavier Yahir

¿ _______cuartos hay en tu casa?
-Siete.

Fill in the blank please. :)

Answers

Hay siete cuartos en mi casa.

how many -Cuantas   i think

this question confused me alot. cuz how am i supposed to know: What did you learn about the different types of schools?
Urban schools:
Rural schools:
Schools in the United States:

xDD

Answers

Answer:

Urban: Young adults who had attended urban schools had lower rates of participation in full-time work or school 4 years after most of them would have left high school, but had similar participation rates 7 to 15 years after high school

Rural: rural school districts receive just 17 percent of state education funding, although they comprise half of all districts and serve one in five students. Smaller rural schools are often at a disadvantage for funding in other ways.

USA schools: Education in the United States is provided in public, private, and home schools.

Explanation:

what they said^^^^^^^^

pls help thx yall i will mark brainliest

pls choose one of the provided answers

Answers

the answer would be (B).

Answer:

The answer is (B

Explanation:

HELP! I NEED HELP! HEEEEEEELP

Answers

1- Yo Estudió
2- Español
3- bailar
4- cantar
5- Yo bailo
6- Yo canto
7-canta
8-Ella toca
9-tocar
10-Yo trabajo
11-cerca
12-detrás


Hope this helps, it’s in order based since the beginning! YOU GOT THIS !
Geoskdnfbfkdkfkgkflldvrv

Please help, thank you!

Answers

Se llama Francisco Jose. Su apellido es López Contardo y su apodo es Chaleco. Su nacionalidad es Chileno y sus cumpleaños es en el 15 de septiembre. Su carrera favorita es Rally Dakar pero so Equipo actual es KTM
Okay, se llama Francisco José su apellido paterno es López y su apellido materno es Contardo, el nació el 15 de septiembre, el es de la nacionalización Chilena, su carreras favoritas es Rally Dakar, el apodo de él es chaleco, el equipo actual de Francisco es el KTM
Other Questions
HELP PLEASE ASAP Read the excerpt from "On Becoming an Inventor" by Dean Kamen.When I was twelve years old and Barton, my older brother, was around fifteen, we took over the family basement. At first, I made a darkroom for developing pictures, and Bart was using it as his lab where he was raising about one hundred white rats, removing their thymus glands, and trying to figure out the glands' dysfunction. He wanted pictures taken of his experiment, doing the surgery on rats, and since I already had a darkroom, I took the pictures, though somewhat reluctantly. I didn't like the blood.What can you conclude about Barton from the excerpt?He was interested in solving medical mysteries at a rather early age.He did not understand why Dean would be squeamish about the blood.He went on to become a very famous and successful doctor.He had a severe dislike for rats and all other kinds of rodents. find the slope of the line passing through the points (-5,5) and (-5,-8) What is the unit rate of 232 people in 8 classrooms? i need help with this pleasee five men build a wall in 10 days how long will it take 10 men Anchara drops a penny from a height of 60 feet above the ground. The equation h=-16t^2 + 60 models the penbys height h i feet as a function of time t in seconds whatvare the solutions P3- is a(n) ______________________, so it ________________ valence electrons. Group of answ er choices anion, gained cation, gained cation, lost anion, lost The following DNA is being replicated and the origin of replication is in the middle of the sequence and marked with three stars ***. 5'ATCGGGCTACCCATGAAATGCTAGCATT***TAAGATCTTAAGCTAGCTAGTTCGATCTGA3'What is the sequence of the primer for the LEADING strand? Your answer should be 8 nucleotides long, written from 5' to 3' and only include the nucleic acid sequence (ex: ACTACTAC).note: there are two answers for this question A farmer's market is selling peaches for $2.00 a pound. If you buy 2 pounds, you save 10% on each pound. How much does it cost to get 2 pounds of peaches? 1. What right do education encompasses both entitlements and freedom?A. Right to free and compulsory primary educationB. Right the quality education in private schoolC. Right to choose yourteachersD. All of the above2. Which of the following is an example of non-formal education?A. Primary schoolingB. Senior high schoolC. Adult night classesD. Doctorate program El libro. _____ Libros. Approximately how many people are likely trafficked into the United States each year?5,5008,5008,50011,50011,500-14,500O 14,50017,500 She dove 75 feet under the sea To be eligible for Bright Futures, you must submit a statement explaining how all money will be repaid submit a plan of action for all courses throughout college take at least three remedial credits in the first semester take at least six non-remedial credits per semesterplease only answer if you know what your talking aboutand if your right i will give brainiest. What was the biggest drawback of Chinese block printing? In a perfectly insulated container of negligible mass, 4.00 102 kg of steam at 100C and atmospheric pressure is added to 0.200 kg of water at 50.0C. A) If no heat is lost to the surroundings, what is the final temperature of the system? B) At the final temperature, how many kilograms are there of steam and how many of liquid water? What is the importance of the Battle of Khanua and Chaunsa? VocabularyMake a sentence using these two wordsdedicated, obstaclecollaborate, techniques 3) Complete the sentences. Use the Past Simple or the Present Perfect Simple form of the verbs in brackets1 Marry_____(win) the lottery last year.2 I _____(not see) anyone yet.(come/just) home.4. They____(buy) the car two years ago5. William still____(not buy) the present for his sister 4 Complete the sentences. Use the Present Perfect Simple or the Present Perfect Continuous form of the verbs inbracts1. The baby's face is really dirty. What____(he/eat)?2. Like____(never/be) abroad3. Eva is exhausted these days. She______(work) too hard recently.4.______(you/finish) your homework yet?5. I_____(clean) all morning I'm really tired! 6x = 10y - 10x + y + 7 = 0What is x and y?