What type of plate boundary lies between the Juan de Fuca plate and North American plates? (one word, all caps)

Answers

Answer 1

Answer:

Transform Plate

Explanation:

I hope that helps. I looked it up on the web

Answer 2

Answer:

TRANSFORM

Hope I helped you out.


Related Questions

How do I calculate a heart rate?

Answers

Explanation:

To check your pulse at your wrist, place two fingers between the bone and the tendon over your radial artery — which is located on the thumb side of your wrist. When you feel your pulse, count the number of beats in 15 seconds. Multiply this number by four to calculate your beats per minute.

The incidence of cystic fibrosis, a recessive genetic disorder in the Caucasian population of United States, is 1 in every 2,500 individuals. Find the number of heterozygous carriers. (p + q = 1, p2 + 2pq + q2 = 1)

Answers

Answer:

The no. of heterozygous carriers = 0.0392

Explanation:

From the given information:

The incidence of this recessive disorder i.e. q² = 1/2500

q² = 0.0004

q = 0.02

From Hardy Weinberg's Equilibrium.

p + q = 1; &

p² + 2pq + q² = 1

p + 0.02 = 1

p = 1 - 0.02

p = 0.98

So, the numbers of heterozygous carrier 2pq is:

= 2 × 0.98 × 0.02

= 0.0392

Where in Nebraska was the oldest known species of horses found? *

Answers

Answer:

Knox County

Explanation:

i live in Nebraska

The oldest known species of horse found in Knox County in Nebraska, Eohippus, (genus Hyracotherium), also called dawn horse, is considered as oldest known species of horse, hence option 1 is correct.

What are the species of horses?

The horse is a mammal considered a domesticated one-toed, hoofed mammal and belongs to the taxonomic family of Equus ferus, there is only one species of a domesticated horse but around 400 breeds developed for the improvement of their strength.

All horses are considered grazers, food like grasses and plants, and believed as herbivores in the tropic level, only plants not animals.

These animals generally use for domestication purposes by human beings for pulling carts and heavy materials.

Therefore, in Knox County of Nebraska, the oldest known species of horses is found, hence option 1 is correct.

Learn more about horses, here:

https://brainly.com/question/30348283

#SPJ2

The given question is incomplete, so the most probable complete question is,

Where in Nebraska was the oldest known species of horses found?

1: Knox County

2: United States

3: Grand Island

4: Omaha

Identity Factors in an Experiment
WARM-UP
Consider what you already know about scientific design. To set up an experiment testing whether
students' grades are affected by their level of exercise, which factors do you think you would need to keep
in mind? Check all that apply.
student gender
vpe of exercise
amount of exercise
what grades are measured
how long the experiment will last
what time of day the students exercise
how much time the students spend studying
DONI

Answers

Answer:

Did you copy and paste this from somewhere because i want to help but i don't understand it at all.

Explanation:

How is an ectotherm most likely to maintain homeostasis during cold weather?
A. By sitting on a warm surface
B. By lying in the shade
C. By shivering
D. By sweating​

Answers

The answer is A! Sitting on a warm surface

Ectotherm describes the animals that use external sources to maintain their body temperature. They will maintain their homeostasis in cold weather by sitting on a warm surface. Thus, option A is correct.

What are ectotherms?

Ectotherms are animals that cannot regulate their body temperature on their own and are dependent on external sources to maintain their body heat.

They have to depend on environmental sources like a warm place to maintain their body temperature during the cold weather. They cannot sweat or shiver to maintain homeostasis.

Therefore, during the cold, ectothermic animals sits on warm surfaces to maintain homeostasis.

Learn more about ectotherms here:

https://brainly.com/question/24181748

#SPJ2

i need help!! i will give 15 points

Answers

D. Most organisms have teeth

Describe some of the reasons for exploring the mid-Cayman ridge.

Answers

Answer:

Life on Earth goes back almost 4.1 billion years, but photosynthesis as characterized by cyanobacteria only appeared around 3.5 billion years ago (Ga). Since life on Earth predates photosynthesis, the exploration of this deep-water environment that lacks any source of light could provide information on what those life forms looked like.

Explanation:

This was the answer on edge

The major reason for exploring the mid-Cayman ridge is to provide

information on what those life forms looked like.

What is Photosynthesis?

This is the process in which plants manufacture their food in the presence

of sunlight and other compounds.

The mid-Cayman ridge which is present in a deep water environment has

lacks any source of light has some life-forms present. The exploration was

to find out the type of life forms present and how they appear.

Read more about Mid-cayman ridge here https://brainly.com/question/2747950

This is for science
What are air pressure, humidity, clouds, and temperature called?
a elevation pressure
b elementary aspects
c elements of weather
d elements of climate

Answers

C. elements of weather

PLEASE HURRY!!!! PLEASE!!!!!!!!!What is different about the way people get energy as opposed to plants?
A. People get their energy from food, whereas, plants convert energy from the sun through a process know as photosynthesis.
B. People get energy from jumping around.
C. Plants and people get energy through the same means.
D. Plants eat zombies to get their energy, whereas, people eat pizza.

Answers

A makes the most sense ;)

Which of the following processes is NOT a physical or chemical change?
a. crushing
b. weighing
c. melting
d. passing electric current

Answers

B. Weighing , because all its checking is the weight.

Answer:

b

Explanation:

doesn't change anything

Some chemical reactions release energy. Others store energy. What important chemical reaction stores energy?​

Answers

Answer: endothermic reaction.

Explanation: A chemical reaction that stores energy is called an endothermic reaction. More energy might be released as products form than the energy needed to break the reactants apart.

Chemical reactions which release energy are called Exothermic reaction whereas the reaction which store energy are called Endothermic reaction. The energy is stored in the form of chemical bonds.

What is Chemical reaction?

A chemical reaction is a process in which chemical transformation of one set of substance is converted into another type of substance.

Chemical reactions are of two types on the basis of energy transfer: Exothermic reaction and Endothermic reaction. An exothermic reaction is the chemical reaction in which the product is formed with the release of energy in the form of heat. For example: Breakdown of glucose through cellular respiration. An endothermic reaction is the chemical reaction in which the product is formed which stores energy in the form of chemical bonds. For example: The formation of glucose.

Learn more about Energy here:

https://brainly.com/question/1371184

#SPJ6

carlos made a diagram to compare two kinds of fish. which label belongs in the area marked Z?

a. scales
b. no jaw
c. swim bladder
d. skeleton made of bones

PLEASE HELP

Answers

Answer:

B

Explanation:

i also do edge

what is the relationship between size and complexity?

Answers

Answer:

"The relational complexity in small groups increases rapidly with small increases in size." a greater rate than does the size of the group." forms of communication," to establish the importance of the concept of organizational com- plexity to the size relationship.

Where in California are most of our hydroelectric power generated?

Answers

Answer:

Explanation:

Where in California are most of our hydroelectric power generated? answer - mostly in the eastern mountain ranges. The state also imports its hydro-generated electricity from the Pacific Northwest and the Southwest.

In the experiment "What Effect Does Vinegar Have on Plant Growth?" some plants were given only water, some were given only vinegar, and the others were given various mixtures of water and vinegar. Which of the following groups is the control group in the experiment?
50% water and 50% vinager
100% water
100% vinager
or 25% vinager and 75% water

Answers

Answer:

50% water and 50% vinegar

Explanation:

What pigment molecule absorbs blue
and red light to provide energy for
photosynthesis?
A. Carotenoid
B. Chlorophyll
C. Melanin
D. Anthocyanin

Answers

Answer:

the answer is b

Explanation:

What happens at the temperature shown?

Answers

Answer:

particles would stop moving

Explanation:

Answer:c

Explanation:

How would a lack of contact inhibition result in the growth and spread of cancerous cells?

Answers

Explanation:

Contact inhibition is a process of arresting cell growth when cells come in contact with each other. As a result, normal cells stop proliferating when they form a monolayer in a culture dish. Contact inhibition is a powerful anticancer mechanism that is lost in cancer cells

Contact inhibition is the property of normal healthy cells where the cells cease growth after coming in contact with each other. A lack of this property results into uncontrolled growth of cells.

What is Contact inhibition?

Contact inhibition is the property of normal healthy cells which enables the cells to cease proliferation and growth when they come in contact with each other. This property is lost by the cell when the cells undergo malignant transformation. As a result, this leads to uncontrolled proliferation and solid tumor formation in the body.

In the in-vivo culture of cells, contact inhibition arrests cell growth and as a result, normal cells stop proliferating when they form a monolayer in the culture dish. Contact inhibition is a powerful anticancer mechanism which is lost in cancer cells.

Learn more about Contact inhibition here:

https://brainly.com/question/20453950

#SPJ2

please HELP me i cant fail this class What are the two forces of gravity that contribute to tectonic plate movement at mid-ocean ridges?

Ridge subduction and slab flight


Ridge slip and slab slide


Ridge push and slab pull


Gravity does not pull them

Answers

Answer:

"Plate movement is thought to be driven by a combination of the motion of the seafloor away from the spreading ridge (due to variations in topography and density of the crust, which result in differences in gravitational forces) and drag, with downward suction, at the subduction zones."

Explanation:

Does this help?

It is because of ridge slip and slab slide i the divergent plate boundaries, where tectonic plates movement creates mid ocean ridges.

What is divergent boundary?

Divergent plate boundaries are the regions where the tectonic plates are diverging from one another, this is known as a divergent plate boundary. Above upward convection currents, this happens.

The lithosphere's base is pushed upward by the rising current, which lifts it off the ground and flows lateral currents beneath it. When an oceanic lithosphere border diverges, the rising convection current beneath raises the lithosphere, creating a mid-ocean ridge.

The plate material above is dragged along in the flow direction by this lateral flow. The overlaying plate is thinned out, fractures, and pulls apart at the peak of the uplift.

Hence, in fact it is not by the gravitational pull but by the ridge slip.

To find more on plate movement, refer here:

https://brainly.com/question/3970445

#SPJ6

coyote
black-footed ferret
hawk
bison
rabbit
prairie dog
blue stem grass
Which argument for protecting the prairie dog best relates to the flow of energy in the ecosystem?
A. Prairie dogs eat grass and other plants that cattle graze on
B. Prairie dogs are an important source of food for many other species.
C Prairie dogs dig in the soil, which improves its quality and helps plants grow.
D. Prairie dogs make burrows which are used as habitat by other important species.

Answers

I think that would be B:  Prairie dogs are an important source of food for many other species.

hope this helps. and please correct me if I'm wrong ^^

C6H12O6+6O2→6H2O+6CO2

In the above equation, glucose is broken down during cellular respiration to produce carbon dioxide and
Select one:
a.
ammonia.
b.
water vapor.
c.
oxygen gas.
d.
sucrose.

Answers

It’s “D” I did this in like 8th grade I think

Answer:

The answer is b. water vapor

Explanation:

I literally just did this question in a benchmark

List some
examples of adaptive evolution:

Answers

Answer:

The changes are the organism's adaptive traits and they arise as a result of natural selection. An example of adaptive evolution is the horse's teeth. Its teeth are one of the traits that made it fit for a grass diet. In contrast, genetic drift produces random changes in the frequency of traits in a population

Explanation:

Answer:

I will give you 5 of them :)

1.Flightless Birds

Birds such as ostriches, emus and penguins are unable to fly. However, this hasn't always been the case — each of these flightless birds has ancestors who easily flew. Over many generations, ostriches and emus evolved to have larger bodies and feet made for running on land, which left them without the ability (or need) to fly. The same goes for penguins, who traded typical wings for swim-friendly flippers over many thousands of generations.

2.Blue Moon Butterfly

The Blue Moon Butterfly on the Samoan islands was attacked by a parasite, which destroyed male embryos. This changed the balance of male and female but that was remedied within 10 generations. This is because the few male moths that were immune lived to breed.

3.Mexican Cavefish

Mexican cavefish once had eyes, but in the caves, eyes were no longer necessary. They have also lost their pigmentation because they no longer need camouflage from predators. This is an example of regressive evolution, the belief that "if you don't use it, you lose it" when it comes to traits.

4.Warrior Ants

These ants have a chemical signal that identifies their colony. Some ants learned to imitate this signal from another colony, so they can attack a colony and take over. The worker ants will not even realize there has been an invasion and continue to work.

5.Pesticide Resistant Insects

Whenever you use a pesticide, it kills the majority of an insect population. However, certain insects will experience a gene mutation to develop immunity to it and those insects will reproduce. This happens very quickly, within a few generations, since the generation length for insects is short.

Explanation:

The changes are the organism's adaptive traits and they arise as a result of natural selection. An example of adaptive evolution is the horse's teeth. Its teeth are one of the traits that made it fit for a grass diet. In contrast, genetic drift produces random changes in the frequency of traits in a population

In three to four sentences, explain the mpact of the spread of Middle Age culture had on ts esstern neightors

Answers


There is one word to describe the culture in the Middle Ages and that is barbaric. While some countries were better than others at maintaining order and the education of their society it was quite a rough time to exist when people had little to no rights.

True or False: When it rains in NYC, the rainwater causes the sewer system to overflow and the excess rainwater is mixed with raw sewage and released into an NYC waterway, such as the Coney Island Creek, Gowanus Canal, and Jamaica Bay.

(This is 7th grade science)

Answers

Answer which middle school

u go to

Explanation: i go to ms.88

Select the correct answer
Linda owns a great deal of land. She decides to rent her land to Andrea. However, she places certain restrictions on Andrea regarding the land use. Linda is using
which rights?
ОА. .
use rights
OB.
alienation rights
OC. management rights
OD. ownership rights

Help need answer ASAP !!

Answers

Management rights.

_______________________

Electron transport from complex I to complex IV pumps more protons than transport from complex II to complex IV.
With this in mind, which will produce more ATP

A. Transport from complex I produces more ATP.

B. Transport from complex II produces more ATP.

C. Both produce the same amount of ATP.

Answers

Answer:

A

Explanation:

ATP synthase uses a proton gradient to make ATP. Since transport from complex I creates a larger proton gradient, it also produces more ATP.

Electron transport from complex I produces more ATP.

ELECTRON TRANSPORT CHAIN:

The electron transport chain, ETC, is the third and last stage of aerobic cellular respiration. It produces the highest molecules of ATP in cellular respiration.

The ETC involves the transfer of electrons to series of molecules in order to create an electrochemical gradient needed for ATP synthesis.

The electron transport chain is made up of four complexes namely: Complex I, II, III and IV. NADH and FADH2 produced in the Krebs cycle are the electron carriers.

Complex I pumps more hydrogen ions (H+) from the mitochondrial matrix to the intermembrane space.

Since the pumped is directly related to the number of ATP molecules, complex I will produce more ATP molecules.

Learn more: https://brainly.com/question/442662?referrer=searchResults

Please helpme ASAP :)))) BRAINLIST I WILL​

Answers

Is there anything you concerned about Shakespeare? Give one sentence Yes or No? Why

Answer:

1. Respiratory System

2. - Not sure -

3. - not sure -

4. Endocrine system

Sorry if I didnt't help much, this is all I know! Don't mark me brainliest if you don't want to :D

I just need these questions answered, you can take your time. I’ll give you 20 points and brainliest if correct!

1. Water (Hydrogen and Oxygen)
A. Element
B. Compound

2. Coal (Carbon)
A. Element
B. Compound

3. Carbon Dioxide (Carbon and Oxygen)
A. Element
B. Compound

4. Oxygen
A. Element
B. Compound

5. Chalk (Calcium, Carbon and Oxygen)
A. Element
B. Compound

6. Wax (Carbon and Hydrogen)
A. Element
B. Compound

7. Table Salt (Sodium and Chloride)
A. Element
B. Compound

8. Caffeine (Carbon, Hydrogen, Nitrogen, and Oxygen)
A. Element
B. Compound

Answers

Water: compound
Coal: I think compound
Carbon dioxide: compound
Oxygen: element
Chalk: compound
Wax: compound
Table salt: compound
Caffeine: compound

During which phases does the moon appear to be fully visible?

Answers

During the waxing phase, the moon is visible in the sky after sunrise and before sunset. Waxing Crescent -- The moon travels eastward in the sky, and a few days after the new moon we can see a slight edge, or crescent, lit by the sun

Answer: New Moon

Explanation: During the new moon phase, the moon is not visible. Sometimes it can be detected by noting the visible absence of the stars that it blocks. Additionally, during new moon, sometimes enough light is reflected off the surface of the Earth that the disk of the moon is faintly visible.

What are the products of photosynthesis?

A. Water and oxygen
B. Glucose and oxygen
C. Carbon dioxide and water
D. Carbon dioxide and glucose

Answers

Glucose and oxygen are products.

Answer:

B. Glucose and oxygen are the products of photosynthesis

Explanation:

I hope it helps ❤️❤️
Other Questions
3(5 + 6)=....................... A businessman wants to buy a truck. The dealer offers to sell the truck for either $120,000 now, or six yearly payments of $25,000.What is the interest rate being offered by the dealer in percentage (rounded to the closest integer number) 30 POINTS HELP Which idea was supported by Aristarchus, Copernicus, and Galileo?The planets have epicycles.The planets revolve around the Sun. The stars rotate around the Sun.The center of the solar system is Earth. The belief that Europeans are the superior class in society is called? Question 1 of 11What are two ways space exploration can improve international relations?DA By urging countries to compete to achieve goalsDB. By helping countries' economies grow weakerDC. By encouraging countries to share scientific dataDD. By inspiring countries to work together to solve problems explain the ides behind majority rule and minority rights 3. Study the changes in population graph, what % lived in cities by the 1930's?By the 1970's? What led the people of France to agree to an imperial dictatorship instead of a true democratic republic like the one selected in the American colonies? why human are not responsible for global warming? Which of the following cells can generate ATP through glycolysis? A. Eukaryotic Cells (Plants and Animals) B. Prokaryotic Cells (Bacteria) C. None of the above D. All of the above What is the length of EF in the right triangle below? Choose one of the three themes (social oppression, greed, or good vs. Evil) and explain something you know about it in the real world OR explain where else you have seen the theme (a book, movie, show, etc.) Please help quick What is f(2) if f(x) = 2x-5 and f(4) if f(x) = -3x + 15step by step please! Solve.Okay here is 20 letters brainy Please which one is the right answer Please help with this What is public participation? Why is itnecessary for environmental conservation AUUUAACUGUUCUGUCUAGAG1. Construct an Explanation Based only on the information provided, why could themRNA section be translated into three different sets of amino acids, instead of just oneset?2. Use Models Use the genetic code to translate the sequence into each of the threepossible sets of amino acids.3. Draw Conclusions Which of the three sets of amino acids is the most likely to beincluded in the polypeptide? Explain your reasoning. Please help me with this homework Different cities have different sales tax rates. Here are the sales tax charges on the same items in two different cities.Complete the tables.