What were the four strategies in the Civil Rights Era?

Answers

Answer 1

Answer:The strategy of public education, legislative lobbying, and litigation that had typified the civil rights movement during the first half of the 20th century broadened after Brown to a strategy that emphasized "direct action": boycotts, sit-ins, Freedom Rides, marches or walks,


Related Questions

What four events that contributed to the causes of the American Revolution.

Answers

Answer: Many elements led to the War of Independence, but we will single out four important ones in this context.

Explanation:

The Boston Tea Party (November 16, 1773) was one of the events that preceded the War of Independence. Namely, the British government decided to reduce the tax on tea from the East India Company. The move implied a monopoly over the tea trade in North America. Such a move was seen as the tyranny and arbitrariness of the colonists. The people decided to board one of the colonial ships on the night of November 16 and throw about 45 tons of tea into the sea. The British authorities acted vigorously on this move. The colonial soldiers were given the authority to punish the rebels without being punished.

Trademark Act (March 1765)

England fought many wars in the period just before the outbreak of the American Revolutionary War. The wars exhausted the state treasury a lot, so they tried to improve the financial situation by imposing taxes in America. The trademark law provided a wide range of taxation of goods in the colonies as early as this was not the case. Until then, many goods, ie, their taxation, resulted from the colonial governments' policy.

Boston Massacre (March 1770)

One of the most common quarrels between a British soldier and a local apprentice led to Boston's bloodshed. A large number of colonists began to push the British soldiers who opened fire on the crowd. The result was three dead colonists. This event was used to spread propaganda against the British.

The Coercive Acts (March-June 1774)

The tea incident in Boston resulted in the Boston port's closure until the damage to tea, which at that moment amounted to about 18,000 dollars, was settled. By further provisions of the British Parliament after this event, many British officials in the colonies were protected by law from the colonial courts for committing certain crimes. If that happened, they could only be tried in English. The same law implied the placement of British soldiers in abandoned buildings. The colonists had to provide food for the army, which led to a lot of hardship.

Answer:The Stamp Act (March 1765)

The Townshend Acts (June-July 1767)

The Boston Massacre (March 1770)

The Boston Tea Party (December 1773)                                                                      The Coercive Acts (March-June 1774)

Lexington and Concord (April 1775)

Explanation:

Europe is connected to Asia in a giant land mass that is sometimes referred to as Eurasia. Question 2 options: True False

Answers

Answer:

True

I hope this helps!

What are the physical characteristics found in Mesopotamia?

Select all correct answers.


abundant rainfall


thick forests


fertile plateaus


river valleys

Answers

Answer:

1) River valleys

2) Fertile Plateaus

Answer: river valley’s and fertile plateaus

Explanation:

i took k12 test trust me

using source 2, which statement best explains how the ideas expressed in the Roosevelt Corollary reflected U.S. actions in Panama shown in Source 1

Answers

Answer:

The Roosevelt Corollary was an addition to the Monroe Doctrine of the 1800s, made by Theodore Roosevelt, President of the United States from 1901 to 1909. According to the Monroe Doctrine, Europeans could not intervene on the American continent; then the Roosevelt Corollary added a stipulation that the United States had priority to intervene there to protect its national interests, both economic and political.

Thus, during the Panamanian revolt in the early 1900s (when it was still part of Colombia), the United States supported the independence revolt, with the objective of guaranteeing itself a space in which to build a canal that connects the Pacific and the Atlantic, protecting its commercial interests.

Which was the only branch of government in the Articles of the Articles of Confederation?
A. Executive C. Legislative
B. Judicial D. Olive

Answers

Answer:

It's the Executive Branch.

during the renaissance from which of all the following cultures did the italians try to imitate their art from

Answers

Answer:

The primary differences between Northern Renaissance art and Italian Renaissance art were the emphasis placed on religion and the anatomical extent to which the human body was portrayed. Northern Renaissance artists were more religious in their approach, while Italian artists were more secular.

Explanation:

How did large coorperations achieve economies of scale

Answers

Answer:

Explanation:

Reducing the cost of units per production is the main benefit of economies of scale. Larger companies are more likely to achieve economies of scale than smaller companies because they are able to produce more goods and therefore can spread out costs over a larger number of goods.

Corporations were able to achieve economies of scale with the money that they raised from the sale of stock, corporations which could invest in new technologies, hire large work forces, and purchase many machines. This ended up increasing the corporations.

1. Father Miguel Hidalgo is speaking out for whose independence? A. Spain B. Mexico C. United States D. England​

Answers

Answer:

Father Miguel Hidalgo is speaking out for Mexico

independent.

6. What put an end to the boom in canal building?
A the introduction of trains
B the population growth in eastern cities
C the growth of turnpikes
D the development of the steamboat

Answers

Answer:

A the introduction of trains

Which of the following was not a reason for domesticating animals? A.food B.labor C.clothing D.protection

Answers

Answer:

it's D

Explanation:

because animal domesticating falls into three main grouping. domestication for companionship like dogs and cats animals farmed for food.

how were kush and axum different​

Answers

Answer:

Two kingdoms in East Africa - Kush and Axum - were no different. Kush began as a conduit for trade between sub-Saharan Africa and the Egyptian Empire of the Nile River. ... Kush was replaced by various kingdoms. Of these, Axum, situated further south, arguably rose to the greatest heights.

Explanation:

which situation would allow a country to increase the value of its imports without increasing the amount of money it spent on trade

Answers

Answer: by increasing the currency.

Explanation:

Jocelyn is running for the U.S Senate. What is one of the qualifications for office she must meet?
A. have resided in the United States for at least 10 years.
B. reside in the state she will represent.
C.have been a member of the U.S. House of Representatives.
D. have served as Governor of the state she will represent.

Answers

Answer:

B

Explanation:

One of the qualifications for Senate office that Jocelyn must meet is that she must  reside in the state she will represent.

The Senate is one of the Unicameral of the United State.

The United State states the following qualifications:

He/She must be of age at least thirty years.He/She must be U.S. citizenship for at least nine years.He/She must reside in the state they wish to represents at time of election.

 

Therefore, the Option B. is correct.

Learn more about this here

brainly.com/question/19214719

25. The problem of the Gideon vs. Wainwright case was that Clarence Gideon
A. was discriminated against because he was African American
B. was denied a lawyer in his trial and had to defend himself
C. burned an American flag
D. sued the US to stop women from voting
26. Gideon won his case due to the
A. 4th Amendment right to privacy
B. 5th Amendment right to due process
C. 6th Amendment right to counsel
D. 7th Amendment write to a jury trial in a civil case
27. The US was sued by Fred Korematsu after Japan bombed Pearl Harbor because
A. the US invaded Japan during WW 2
B. the US put Japanese Americans in camps during WW 2 whether they were citizens or not
C. the US only put Japanese immigrants, and not Japanese American citizens in camps
D. he was denied the right to vote in California
28. Fred Korematsu lost his case because
A. he was not a citizen
B. he was a citizen
C. it was during a war, so it was a military necessity
D. he was protesting against the war

Answers

The correct answers are
25.B
26.D
27.B
28.C (I am not sure)

why did Naacp support lawsuits against public institutions such as university of oklahoma? how did these lawsuits realated to the issue of intergation​

Answers

Answer:

Under Houston's “equalization strategy,” lawsuits were filed demanding that the ... to maintain black schools that were actually equal to those reserved for whites. ... In this landmark decision, the Supreme Court held that segregation in public ... of corporate hotel policies that discriminate against African-American college

Explanation:

Answer:

Responses may vary but should include some or all of the following information: The NAACP sought candidates like Ada Lois Sipuel and George McLaurin, who attempted to attend the University of Oklahoma. They believed that this education was a right guaranteed them by the Constitution. By suing public institutions that had violated African Americans’ civil rights, the NAACP hoped to call attention to the hypocrisy of Jim Crow laws. Public institutions claimed to have “separate but equal” policies and facilities established by the US Supreme Court’s 1896 Plessy v. Ferguson ruling. However, the NAACP court cases revealed that segregation could not even meet this standard.

Explanation:

How were nativist & racial sentiments of the 1920's evident in American society?

Answers

Answer:

The old and the new came into sharp conflict in the 1920s. While many Americans celebrated the emergence of modern technologies and less restrictive social norms, others strongly objected to the social changes of the 1920s.

In many cases, this divide was geographic as well as philosophical; city dwellers tended to embrace the cultural changes of the era, whereas those who lived in rural towns clung to traditional norms.

The Sacco and Vanzetti trial in Massachusetts and the Scopes trial in Tennessee revealed many Americans’ fears and suspicions about immigrants, radical politics, and the ways in which new scientific theories might challenge traditional Christian beliefs.

Explanation:

What's the difference between justice and revenge?​

Answers

Answer:

Justice is being fair or giving punishment that is well deserved to any person. A good example of justice is a police officer arresting a murderer and putting him away in jail for a very long time. Revenge is harming someone who has did something wrong to you. A good example of revenge is a father killing his sons bully, as if seems that both are giving that person what they deserve "revenge is more harsher then justice because you're inflicting pain on that person who has did you wrong, not giving fair treatment to that person."

Hope this helps.

How could political campaigns be improved

Answers

Answer:

By letting others speak while one is talking, by getting to the point about a topic, and also by being respectful towards one another because it's a campaign to prove your point, not be rude and judgmental.

Explanation: Hoped this helps! :)

What is the purpose of the second amendment?

Answers

Answer:

The Second Amendment (Amendment II) to the United States Constitution protects the right to keep and bear arms. It was ratified on December 15, 1791, along with nine other articles of the Bill of Rights.

The Second Amendment, one of the ten amendments to the Constitution comprising the Bill of Rights, states: “A well regulated Militia, being necessary to the security of a free State, the right of the people to keep and bear Arms, shall not be infringed.” The meaning of this sentence is not self-evident, and has given.



Hopes this will help you

How did goods get transported during the cattle trail?

Answers

Answer:

The westward development of the railroad system shortened cattle drives. The first rail-transported cattle were shipped from Abilene, Kansas in 1867. Other rail centers were soon established. Thereafter, thousands of animals were moved along the various cattle trails which led to these shipping points.

Explanation:

Why did the United States send military aid to South Vietnam?

Answers

The United States sent aid to Southern Vietnam due to the ideological conflicts between South and North Vietnam. As the North Vietnamese were being aided by communist countries like China and the Soviet Union. This irritated the United States and did not want Vietnam to fall into Communism. They were also worried about the "Domino Effect" which meant once Vietnam became communist, so would Laos, Cambodia, Thailand, Myanmar, etc.

In the ancient world, all of the following were characteristics of common citizens EXCEPT:
A.
They were rarely educated.
B.
They had no voice in government.
C.
They were not active in government.
D.
They could move up the social and economic ladder with hard work.



Please select the best answer from the choices provided


A
B
C
D

Answers

Answer:

I'm pretty sure the answer is d

Answer:

The answer is d they could move up the social and economic ladder with hard work.

Explanation:

Which of the following is a name representing many women who helped in the war effort?

Answers

Answer:Rosie the Riveter was an allegorical cultural icon of World War II, representing the women who worked in factories and shipyards during World War II, many of whom produced munitions and war supplies.

Explanation:

what was the best dinsny show

Answers

Mickey Mouse clubhouse :))))))) lol

Answer:

Lizzie McGuire

Explanation:

20 points + Brainliest PLZ HELP DUE RIGHT NOW
Industrialization led to rapid urban growth which led to (4 points)

a overcrowding and dangerous conditions
b utopian communities
c immigration increases
d food surpluses and increased wages

Answers

Answer:

a

Explanation:

PLEASE HURRY
”Senators have increasingly used holds, their ability to block consideration of a nominee indefinitely, as a broader partisan weapon to keep presidents from filling key positions, including many qualified and usually noncontroversial nominees . . . . The confirmation rate of presidential circuit court appointments has plummeted from above 90 percent in the late 1970s and early 1980s to around 50 percent in recent years.”

Thomas E. Mann and Norman J. Ornstein, It’s Even Worse than it Looks, 2012

Based on the text, which of the following statements would the authors most likely agree with?


A

Divided government has led to the Senate's decrease in the use of filibusters when confirming presidential appointments


B

Divided government has had little impact on the president’s ability to achieve presidential initiatives or get confirmation on presidential nominees

C

Divided government has led to an increase in congressional refusal to confirm appointments of presidents of the opposite party


D

Divided government leads to a more effective congressional process for negotiating appointee confirmations

Answers

D !!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!

Answer:

C Divided government has led to an increase in congressional refusal to confirm appointments of presidents of the opposite party

Explanation:

I got it right on Khan Academy

The three regions of Latin America are:
A.)Middle, Central, Southern and Western
B.)Eastern, Western, and Caribbean
C.)Mexico and Central
D.)Middle America, Caribbean, and South

Answers

Answer:

D - Middle America, Caribbean and South

Explanation:

Well the question says 3 regions so it cant be A or C.

Mexico and Central are the same thing so... nope.

Western part belongs to the US which is California, Nevada....etc..

Middle America(central) is part of Latin America. So is South America and the Caribbean.

Hope this can help!

:)

Who served as the first elected president of the independent Texas?

Answers


Sam Houston was the first


hope this helps

Which of the following expresses a cause of the increased specialization of labor?
A. Economic power of monasteries
B. Beginning of a cash economy
C. Greater role of banks in lending
D. Growth of towns and cities

Answers

A

Explanation:

A is the correct answer

Answer:

B or D

Explanation:

meaning of the official seal of negros oriental

Answers

Answer:

The official seal of the Province of Negros Oriental comprises of a crest surrounded by the motto “Via, Veritas, Vita” from Silliman University (as the province is widely known for being a university town). The crest is divided into two parts with the upper portion showcasing the Cuernos de Negros mountain ranges embracing the Provincial Capitol Building with Silliman University’s Portals in front. The lower portion presents the popular industries and produce of the province before which are lumber, coconut and sugar mills.

Explanation:

Hope this helped!

Other Questions
Helppp plzz!! A.) Side - Side - SideB.) Side - Angle - SideC.) Angle - Side - AngleD.) Angle - Angle - SideE.) Hypotenuse - LegF.) Not enough information. my picture please hahahahahahah Read the excerpt from The Dark Game: True Spy Stories from Invisible Ink to CIA Moles.Tension between the two sides escalated until June 1948, when the Soviets blocked all western access to the capital. In this first real crisis of the Cold War, the West was not going to be denied by the Soviets.If the underlined word were replaced with the word "event, the tone of the excerpt would bemore resentful.more intellectual.less intense.less objective. how might have the oppressive British rule influenced the ideas of the articles of confederation ? A collection of the same kind of cells working together to do the same job HELP PLEASE ASAP Read the excerpt from "On Becoming an Inventor" by Dean Kamen.When I was twelve years old and Barton, my older brother, was around fifteen, we took over the family basement. At first, I made a darkroom for developing pictures, and Bart was using it as his lab where he was raising about one hundred white rats, removing their thymus glands, and trying to figure out the glands' dysfunction. He wanted pictures taken of his experiment, doing the surgery on rats, and since I already had a darkroom, I took the pictures, though somewhat reluctantly. I didn't like the blood.What can you conclude about Barton from the excerpt?He was interested in solving medical mysteries at a rather early age.He did not understand why Dean would be squeamish about the blood.He went on to become a very famous and successful doctor.He had a severe dislike for rats and all other kinds of rodents. find the slope of the line passing through the points (-5,5) and (-5,-8) What is the unit rate of 232 people in 8 classrooms? i need help with this pleasee five men build a wall in 10 days how long will it take 10 men Anchara drops a penny from a height of 60 feet above the ground. The equation h=-16t^2 + 60 models the penbys height h i feet as a function of time t in seconds whatvare the solutions P3- is a(n) ______________________, so it ________________ valence electrons. Group of answ er choices anion, gained cation, gained cation, lost anion, lost The following DNA is being replicated and the origin of replication is in the middle of the sequence and marked with three stars ***. 5'ATCGGGCTACCCATGAAATGCTAGCATT***TAAGATCTTAAGCTAGCTAGTTCGATCTGA3'What is the sequence of the primer for the LEADING strand? Your answer should be 8 nucleotides long, written from 5' to 3' and only include the nucleic acid sequence (ex: ACTACTAC).note: there are two answers for this question A farmer's market is selling peaches for $2.00 a pound. If you buy 2 pounds, you save 10% on each pound. How much does it cost to get 2 pounds of peaches? 1. What right do education encompasses both entitlements and freedom?A. Right to free and compulsory primary educationB. Right the quality education in private schoolC. Right to choose yourteachersD. All of the above2. Which of the following is an example of non-formal education?A. Primary schoolingB. Senior high schoolC. Adult night classesD. Doctorate program El libro. _____ Libros. Approximately how many people are likely trafficked into the United States each year?5,5008,5008,50011,50011,500-14,500O 14,50017,500 She dove 75 feet under the sea To be eligible for Bright Futures, you must submit a statement explaining how all money will be repaid submit a plan of action for all courses throughout college take at least three remedial credits in the first semester take at least six non-remedial credits per semesterplease only answer if you know what your talking aboutand if your right i will give brainiest. What was the biggest drawback of Chinese block printing?