WILL MARK BRAINLIEST
Select the correct answer.
Which factor is critical to the successful implementation of IS?

WILL MARK BRAINLIEST Select The Correct Answer.Which Factor Is Critical To The Successful Implementation

Answers

Answer 1
Answer: E visibility of products in real time

Related Questions

Stoneheart Group is expected to pay a dividend of $2.87 next year. The company's dividend growth rate is expected to be 4 percent indefinitely and investors require a return of 10.2 percent on the company's stock. What is the stock price?

Answers

Answer:

The share price = $46.29

Explanation:

The share price = Next year dividend / (Required return - Growth rate)

The share price = 2.87 / (0.102 - 0.04)

The share price = 2.87 / 0.062

The share price = 46.29032258064516

The share price = $46.29

Match the jobs with the career clusters

FOR PLATO EXPLORING CAREER OPTIONS POST TEST!

Health Science


Hospitality and Tourism



Human Services


List of Careers:
- Radiologist
-Sociologist
-Concierge
-Nurse Practitioner
-Meeting Planner
-Adult Care Counselor

?

Answers

Answer:

Health Science - Radiologist, Nurse Practitioner

Hospitality and Tourism - Concierge, Meeting Planner

Human Services - Sociologist, Adult Care Counselor

There are different career: Health Science: Nurse Practitioner, radiologist. Hospitality and Tourism: meeting planner, concierge. Human Services: adult care counselor and sociologist.

Various occupations connected to healthcare and medicine are included in the health science career cluster. Radiologist and Nurse Practitioner are two professions that fall within this cluster.

The hospitality and tourism career cluster covers a variety of occupations that are connected to the management, marketing, and operation of eateries, accommodation, attractions, leisure activities, and travel-related services.

The human services career cluster encompasses a variety of occupations dedicated to helping people and communities.

Learn more about the career, here:

https://brainly.com/question/8825832

#SPJ2

Manufacturing overhead data for the production of Product H by Shakira Company are as follows.

Overhead incurred for 52,000 actual direct labor hours worked $263,000
Overhead rate (variable $3; fixed $2) at normal capacity of 54,000 direct labor hours $5
Standard hours allowed for work done 52,000

Required:
Compute the total overhead variance.

Answers

Answer:

$3,000 (A)

Explanation:

Total overhead variance is the difference between actual fixed overhead cost and overhead budgeted cost. Budgeted overhead cost is overhead rate multiplied by actual direct labor hours , while overhead rate is the total of variable overhead and fixed overhead rate.

Total overhead cost variance is computed as;

= Actual fixed overhead cost - Budgeted overhead

= $263,000 - ($5 × 52,000)

= $263,000 - $260,000

= $3,000 (A)

Therefore total overhead cost variance is $3,000 (A).

he principle of indemnity does not apply to Select one: a. health Insurance. b. home Insurance. c. life Insurance. d. auto Insurance. e. pet Insurance.

Answers

Answer:

c. life Insurance.

Explanation:

The principle of indemnity put an individual who is in loss into the same financial position as he was before the loss.

The insurers ensure such individual is immediately reinstated into his previous position. They do not give more than what was lost they give the exact thing that was insured and lost. Even if the sum insured is more than the actual value of the property or this would not entitle the insured to get more than the actual loss

Life insurance and body insurance is not under indemnity principal because life can not be valued the same way as property and it cannot be refunded. Also, body part loss cannot be restored back to its original position hence they do not come under the principle of indemnity.

You have yet to meet with the folks in Finance at Informational Systems as part of your consulting work for Workplace Solutions Consulting, so you contact the admin for the CFO to set up a meeting. You are told that the CFO is on travel, but you could meet with the Director-level people the next day. At that meeting you get the three Directors in a conference room where they proceed to open up and share their frustrations with working with the CFO. They state that she is difficult to work for because she doesn’t listen to anyone and makes all decisions without consulting them at all

Discussion Part 1: What type of leadership is the CFO displaying? What are the benefits of this type leader? What are the limitations? Under what conditions would this type of leadership be successful?

Answers

Answer:

autrotractic

Explanation:

benefits. ,improves productivity

reduces stress

counters tea, inexperience

You are starting your own small business in Albuquerque. You borrow $10,000 from the bank at a 9% rate for 5 years. What is the total amount you will pay on this loan.

Answers

Answer:

4,500

Explanation:

Use the I=PRT method to help

P=10,000      T=5 years     R=9%=9/100=0.09

this is going to be your equation

I=10,000 x .09 x 5

multiply you t x r

it should now look like this,

I=10,000 x .45

now the last thing to do is just multiply them both.

you should get,

I=4500

_____refers to how openly a society or culture accepts or does not accept differences between people, as in hierarchies in the workplace or in politics.

Answers

Answer:

Power distance

Explanation:

Power distance refers to the extent to which those in power distance themselves from their subordinates or those that have have lower level of power.

Usually there is a hierarchy created by varying degrees of power in the society.

People with low in a community restrict themselves to their place. They accept that power is unequally divided with little or no resistance to those with higher power level.

So it is indicative of level of acceptance of power differences in the community

The slope of the budget constraint A. measures the rate at which the consumer can trade one good for another. B. equals the relative price of the two goods. C. reflects the trade-off the market is offering the consumer. D. all of the above are correct.

Answers

Answer:

B. equals the relative price of the two goods.

Explanation:

A budget constraint refers to how much money a person or a company has to spend in any given pair of goods or services, e.g. you have $10 and you want to eat hot dogs and drink Coke.

The slope of the budget constraint refers to the relative price of the two goods or services, e.g. a hot dogs costs $2 and a Coke costs $1.50. The slope of the budget constraint = $1.50 / $2 = 0.75. The slope of a budget constraint is always equal or less than 1, that is why the smallest value is the numerator.

A set of values based on desirable workplace characteristics that include accountability, dependability, initiative taking, and accomplishment is called:

Answers

Answer:

work ethic

Explanation:

The work ethic represents the belief in ourselves to do the hard work that surely gives the benefit in future. It could be done by your character and skills & abilities.

Also it involves various attributes like, accountability, dependability, achievements, etc

Therefore according to the given situation, the work ethic is the answer and the same is to be considered

A bond had a price of $1,945.77 at the beginning of the year and a price of $1,977.81 at the end of the year. The bond's par value is $2,000 and its coupon rate is 4.8 percent. What was the percentage return on the bond for the year?

Answers

Answer: 6.58%

Explanation:

The percentage return on the bond for the year will be calculated thus:

= (Ending price + Interest - Initial price) / Initial price

= ($1977.81 + $96 + $1,945.77) / $1,945.77

= 0.0658

= 6.58%

Note that interest was calculated as:

= 4.8% × 2000

= 0.048 × 2000

= 96

hello guys my name is lonatho if u want help u can ask me any question

Answers

Explanation:

What is global warming

how do you make a placement in marketing

Answers

About placement:

The process of making a product or service accessible for use or consumption by a consumer or business user, using direct means, or using indirect means with intermediaries.

Main Question:

How do you make a placement in marketing?

Answer:

Use your social media channels to reach out to industry influencers. Create awareness and interest for your products by sharing with those who may be able to do some product placement on their own channels. Prepare Press Kits.

▬▬▬▬▬▬▬▬▬▬▬▬

Estelle has 30 years of experience in your field that has answered your questions given you advice and help you make contact she is your

Answers

Answer:

a). mentor

Multiple-choices

a). mentor b). notary c).  referral d). coach

Explanation:

A mentor is an expert and experienced person who offers to guide a less experienced individual. The purpose of mentorship is to give the inexperienced person exposure and on the job training so that they can excel as the mentor.

The mentor helps build the mentee's confidence and models positive behavior. They fast-track their mentee's career by giving advice, useful tips,  introducing them to important contacts. A mentor should be reliable, show commitment, and believe in their mentee.

If you where advising someone on developing a "marketing communications plan", what factors would you address in this selection process?

Answers

Explanation:

Marketing Communications Plan can be described as the technique that an organisation or individual uses to attract the attention of consumers through different forms of communication.

Factors to address in the selection of a Marketing Communications Plan is as follows:

1. The first factor to keep in mind is the target market or your target customers.

2. The second factor is the goals and objectives of the said plan.

3. Another important factor is the budget allocated for the plan.

4. Fourth factor is the advertising and promotional policies.

An increase in a firm's tax rate will__________ if the firm has debt capital in its capital structure:

a. increase both the cost of preferred stock and debt.
b. decrease the cost of preferred stock.
c. increase the firm's WACC.
d. decrease the firm's WACC.

Answers

Answer:

d. decrease the firm's WACC.

Explanation:

As per WACC formula

WACC = ( Weight of Common Equity x Cost of Common Equity ) + ( Weight of Common Debt x Cost of Common Debt x ( 1 - Tax rate ) ) + ( Weight of Preferred Equity x Cost of Preferred Equity )

By assuming the values to prove the answer

Weights

Common equity = 55%

Preferred Equity = 15%

Debt = 30%

Costs

Common equity = 15%

Preferred Equity = 8%

Debt = 12%

Tax rate is 15%

Placing values in the formula

WACC = ( 55% x 15% ) + ( 30% x 12% x ( 1 - 15% ) ) + ( 15% x 8% )

WACC = 8.25% + 3.06% + 1.2% = 12.51%

Keeping others values constant, Now increase the Tax rate to 25% and placing vlaues in the formula

WACC = ( 55% x 15% ) + ( 30% x 12% x ( 1 - 25% ) ) + ( 15% x 8% )

WACC = 8.25% + 2.7 + 1.2% = 12.15%

Hence the WACC is decreased from 12.51% to 12.15% when the tax rate is increased from 15% to 25% keeping other values constant.

For a given significance level, if the calculated value of the Durbin Watson statistic lies between the lower critical value and the upper critical value, _____.a. the hypothesis of no serial correlation is accepted b. the hypothesis of no serial correlation is rejected c. the test is inconclusive d. the hypothesis of heteroskedasticity is accepted

Answers

Answer:

c. the test is inconclusive

Explanation:

In statistic, Durbin-Watson statistic test is used for testing the auto correlation present in residual and regression analysis. Auto correlation means it works as lagged correlation between variable's current value and variable's past value. For a given significance level, if the calculated value of the Durbin Watson statistic lies between the lower critical value and the upper critical value the test is inconclusive.

What is a classic marketing exercise that is used to declare that one’s own food or drink product is superior to the market leader?

Answers

Answer:

Blind taste test

Explanation:

As the name suggests the blind taste test is the test i.e. taken for tasting the food having blindfold where you are not aware of which brand of food you are tasting. You can judge by tasting it

So here in the given situation, if the own food or the drink product is declared so it would become superior to the leader of the market. This case would applied in the blind taste test

Therefore the same is to be considered

The people in an economy have $10 million in money. There is only one bank that all the people deposit their money in and it holds $0.5 million as required reserves. What is the money multiplier in this economy?
a. 1
b. 5
c. 10
d. 20

Answers

Answer: d. 20

Explanation:

The Money multiplier is the number that new deposits are multiplied with to find out their total effect on the banking system.

It is calculated by dividing 1 by the required reserve ratio.

Required reserve ratio = 0.5/10

= 5%

Money Multiplier = 1/5%

= 20

Xylo, a calendar-year C corporation, acquired the assets of Yerkes, also a calendar-year C corporation, on March 1 of the current year. One of the assets acquired was a trademark to which Xylo properly allocated $1,200,000 of the purchase price. What is Xylo's amortization deduction for the current year?

Answers

Answer:

$66,667

Explanation;

Calculation for the amortization deduction for the current year

The value or amount of trademarks that is been acquired due to the conduct of either a trade or business will be amortized over a period of 15-year

Hence:

Amortization deduction for the current year=[($1,200,000 ÷ 15 years) ÷ 12 months] × 10 months

Amortization deduction for the current year=$66,667

Note that March 1 to December 31 December will give us 10 months

Therefore the Amortization deduction for the current year will be $66,667

Imagine that you have a new idea that you want to pitch to your supervisor at work. They said you could have 5 minutes to pitch--what is the first thing you'd want to do in the pitch?

a. Create a way to satisfy a need.
b. Make a call to action.
c. Get their attention.
d. Demonstrate a need.

Answers

Answer:

D

Explanation:

The idea is the solution to the problem therefore, present the problem to your supervisor and show him the solution

A pitch is a process of presenting an idea to someone who has the authority to act on it. It is the art of projecting a concept to gain as much support as possible, and an effective pitch emphasizes benefits.

Option D is the correct answer because;

When pitching an idea to the supervisor at work an individual has to touch the need inside the target and flourish that area of concern to interest the supervisor.  

When the need is answered, the automatic attention to understanding the idea will be the next step.  

Therefore, knocking the need and answering the need through the pitch is the primary thing the employee has to do at work to impress the supervisor.  

For more information regarding the pitching idea, refer to the link:

https://brainly.com/question/16158081

What evidence demonstrating your own leadership development have you gathered so far? (please list)

Answers

Answer:

The evidence that shows my own leadership development is:

Communication capacity Organization Calm and rationality proactivity ability to work as a team.

Explanation:

Although there is still a long way to go for me to consider that I have a strong leadership spirit, I can consider some evidences in my personality and my abilities that announce that I have developed as a leader. Among these evidences I can mention my ability to communicate with people, explaining concepts and attitudes that we must have to reach our goals. This is linked to my ability to work as a team, managing it to success.

They are also a calm and rational person, which shows that I will have good control in the face of difficulties that may arise, without forgetting that I am very proactive and organized, which will facilitate the work to be done.

Business Scenario
An employee realized that he gave a shortchange to
a customer who already left the store premises. The
right change is 694 pesos, but he only gave 194
pesos. Discuss what business ethics issues present
on this situation. What can be done?​

Answers

Answer:

a misscommunication, to be prevented they can be different ways of settling.

Explanation:

As a general rule, we can close more sales by: __________

a. increasing the amount of actual selling time
b. decreasing the time allocated to active listening
c. decreasing the amount of detail in the sales presentation
d. increasing the amount of traveling time

Answers

Answer:

E) using confirmation questions to determine if we are on the right track

Explanation:

CHECK COMPLETE QUESTION BELOW

As a general rule, we can close more sales by: __________

a. increasing the amount of actual selling time

b. decreasing the time allocated to active listening

c. decreasing the amount of detail in the sales presentation

d. increasing the amount of traveling time

e.using confirmation questions to determine if we are on the right track

Closing of sales can be regarded as as a break/ make moment in the sales of a company To close more sales one need to Do research and set some expectation then pitch the suction and know how to handle objection then one can now ask for the sale.

Salespeople that do engage in who closing technique do reiterate the goods that are hopefully purchasing by consumer. It should be noted that As a general rule, we can close more sales by using confirmation questions to determine if we are on the right track

David Burdick is the CEO of ACME Bubblegum, a successful public company. As one of the cofounders of the company, Burdick has enjoyed speaking and writing about the success of ACME Bubblegum for several years. Typically, he speaks at conferences or directly to the press, but recently, he has been blogging about his firm anonymously. Specifically, he defended a recent advertising campaign that was unpopular among consumers and pointedly attacked one of ACME Bubblegum’s competitors. Burdick deeply enjoys his anonymous blogging and believes that none of his readers actually know that he works for ACME Bubblegum.

Should Burdick be allowed to praise his company’s performance anonymously online? Should he be allowed to attack his competitors without disclosing his relationship with the company? How would you feel if the CEO of a company at which you shopped was secretly writing criticisms of his or her competition? How would you feel if you knew a writer for your favorite blog was actually closely involved in a company that the blog discussed?

1. Define the ethical issue?
2. Who are the primary stakeholders?
3. What are the possible alternatives?
4. How could you evaluate the ethical implications of the alternative actions (use appropriate decision rules)?
5. What action would you recommend and why?

Answers

Answer:

Ethical practices is a must in an organization. Organization which practices best ethical practices survives in the market.

Explanation:

1. The ethical issue in the above context is that the company CEO is secretly swaying the buying behavior of the consumers without revealing his identity in favor of the products of his company. As a result, the consumers blindly believes him to be some independent external expert. The CEO of the company is taking advantage of his customer's trust.

2. The primary stake holders are :

   - the readers and the society

   - the consumers

   - the CEO and his teams

   - the owners of the company

3. The possible alternatives :

 -- the CEO should disclose his identity to the readers and should provide constructive criticism to his competitors.

-- by disclosing himself and advertising or writing only about his company's product.

-- stop writing about the products and disclose his identity.

4. With the first alternative, by disclosing the identity of the CEO will help the buyers or the readers to take decisions wisely as they will know who the writer or critic is of the product. This also leads to confusion of the customers as it leads to ambiguity of the market, as the criticism of other players in the market will be similar.

With the second alternative, the consumers will get information or an idea about the products of the company. The readers can read and follow the bloggers of their choice if the identity identity is known to them. It is right practice to disclose oneself and one's opinion about the products and let the readers decide what is good for them.

With the third alternative, the readers and the consumers are devoid of the views of the blogger of their choice. It is not good for any of the readers, bloggers or for the consumers also. If someone is in the CEO position, the freedom of expression should not be curtailed.

5. Alternative second is considered the best alternative because :

- readers are aware of the identity of the blogger.

- the blogger can disclose his identity and continue his blogging

- now the consumer can best choose their product based on their research and knowledge

A seller has accepted an offer from John. John wants to remodel and add an outdoor pool when he has enough equity built up to cover the project. Which loan arrangement will help him build equity faster than the others?

Answers

Answer:

make a 40% down payment upfront

Explanation:

The best arrangement that would help him accomplish this would be to make a 40% down payment upfront. The best way to build equity as fast as possible is to put down the biggest down payment that you can. The bigger the down payment, the higher the boost in equity that you will receive. That is why it is the best option. Anything above 20% down payment is the ideal scenario, while 40% would be perfection.

The following trial balance was extracted from the books of Kalekeno, a sole trader, at 31st Dec2018:

Dr Cr

Stock DEC 31st 2017 23,680



Carriage outward 2,000



Carriage inwards 3,100

Returns 2050 3,220

Purchases and sales 118,740 186,000

Salaries and wages 38,620

Rent 3040

Insurance 780

Motor expenses 6,640

Office expenses 2160

Lighting and heating expenses 1,660

General expenses 3140

Premises 50,000

Motor vehicles 18,000

Fixtures and fittings 3,500

Debtors and creditors 38,960 17,310

Cash at bank 4820

Drawings 12,000

Capital 126,360

332,890 332,890

Additional information

i) Closing stock was valued at ksh 29,460 as at 30th June 2018

ii) Mr kalekeno took part of the stock amounting to ksh 3000 for personal use

iii) Salaries and wages amounting to ksh 8,000 were pre-paid and ksh 360 of motor expenses accrued

iv) Bad debts written off amounted to 860

v) Depreciation is to be provided for as follows:

 Premises at 20%

 Fixtures and fittings at 15%

 Motor vehicles at 25%

All of a above asset were depreciated at cost

a) The income statement for the year ended 30 th June 2018 ( 5marks)

b) The statement of financial position (5 Marks)​

Answers

Answer:

do you still need help?

Explanation:

Samson purchased some equipment for $86,749 on March 15, 2017. He decided he did not need the equipment and sold it on March 10, 2018 for $82,000. The equipment was subject to depreciation of $16,851 for 2017 and 2018. What gain or loss will Samson recognize on the sale of the equipment?
A. $4,749 ordinary loss.
B. $12,102 ordinary gain.
C. $12,102 capital gain.
D. $4,749 capital loss.

Answers

$12,102 ordinary gain.

A(n) ________ represents a condensed version of the registration statement that enables prospective investors to evaluate a stock for possible purchase.

a. insider report
b. securities disclosure
c. evaluative report
d. prospectus

Answers

Answer:

D. prospectus

Explanation:

prospectus is a term used in company law, it can be regarded as a formal and legal document that are used for invitation of offers from the public, so that public can subscribe to or purchase any securities. prospectus is basically a formal and legal document issued by a body corporate which acts for inviting offers from the public for subscription or purchase of any securities.prospectus is usually issued by a body corporate. And in this case the entitlement on issueing of prospectus is open to the every public company so that they can issue prospectus for shares or debentures, however not required as far as private company is concerned. It should be noted that prospectus represents a condensed version of the registration statement that enables prospective investors to evaluate a stock for possible purchase.

An individual investor or other entity (such as a company or mutual fund) who invests money in the hope of reaping a profit.

Investors use a wide range of financial vehicles to generate a return and achieve critical investment targets such as creating extra wealth over time, establishing retirement savings, or supporting college education.

The correct answer is D. prospectus

A presentation is a terminology used in corporate law that refers to a formal legal document used to invite offers from the public in order for the public to subscribe to or purchase shares.

A prospectus is an appropriate legal document issued by the company for the purpose of requesting public proposals for the subscription or purchase of securities. A prospectus is typically issued by a company.

To know more about the prospectus, refer to the link below:

https://brainly.com/question/11350043

Bonanza Gold’s common stock currently sells for $32 per share. Bonanza’s investment banker charges 6.5 percent flotation costs when new common stock is issued. The company expects to pay a $3.36 per share dividend at the end of the year. If Bonanza’s cost of retained earnings is 15.5 percent, what is its cost of new common equity?

Answers

Answer:

16.23%

Explanation:

The formula share price below can be used to determine the cost of new common equity by making the cost of equity Ke the subject of the formula as below:

cost of retained earnings=dividend/share price+dividend growth rate

15.5%=$3.36/$32+dividend growth rate

dividend growth rate=15.5%-($3.36/$32)=5.00%

Cost of new equity=dividend/share price(net of flotation cost)+dividend growth rate

share price(net of flotation cost)=$32*(1-6.5%)=$29.92

Cost of new equity=($3.36/$29.92 )+5.00%

cost of new common equity=16.23%

Pablo owns a record store. His total costs are $1.2 million per year, his variable costs are $750,000, and his fixed costs are $450,000 per year. Last year, Pablo sold 1,200 records. If Pablo sells 1,250 records this year (50 more than last year) and his average total cost increases to $1.28 million, we know that the: ________

a. average variable cost of selling records has decreased.
b. marginal cost of those 50 records is $80,000.
c. average fixed cost of selling records is unchanged.
d. marginal cost of those 50 records is $1.28 million.
e. average total cost of selling 1.250 records is $1,000.

Answers

Answer:

b. marginal cost of those 50 records is $80,000.

Explanation:

The computation is shown below:

The average cost of selling 1,200 records is

= $1,200,000 ÷ 1,200

= $1,000

Now

The average total cost of selling 1,250 records is

= $1,280,000 ÷ 1,250

= $1,024

Now for the extra 50 records, the marginal cost is

= $1,280,000 - $1,200,000

= $80,000

Hence, the correct option is b.

Other Questions
what were the political limitations of african american during 1865-1900? one paragraph the sunshine Club collected 524 cans for a canned food drive. the cans were then split up equally into 8 boxes. Part A how many can were in each box? Part B how many can were left over after the boxes were filled? Helppp plzz!! A.) Side - Side - SideB.) Side - Angle - SideC.) Angle - Side - AngleD.) Angle - Angle - SideE.) Hypotenuse - LegF.) Not enough information. my picture please hahahahahahah Read the excerpt from The Dark Game: True Spy Stories from Invisible Ink to CIA Moles.Tension between the two sides escalated until June 1948, when the Soviets blocked all western access to the capital. In this first real crisis of the Cold War, the West was not going to be denied by the Soviets.If the underlined word were replaced with the word "event, the tone of the excerpt would bemore resentful.more intellectual.less intense.less objective. how might have the oppressive British rule influenced the ideas of the articles of confederation ? A collection of the same kind of cells working together to do the same job HELP PLEASE ASAP Read the excerpt from "On Becoming an Inventor" by Dean Kamen.When I was twelve years old and Barton, my older brother, was around fifteen, we took over the family basement. At first, I made a darkroom for developing pictures, and Bart was using it as his lab where he was raising about one hundred white rats, removing their thymus glands, and trying to figure out the glands' dysfunction. He wanted pictures taken of his experiment, doing the surgery on rats, and since I already had a darkroom, I took the pictures, though somewhat reluctantly. I didn't like the blood.What can you conclude about Barton from the excerpt?He was interested in solving medical mysteries at a rather early age.He did not understand why Dean would be squeamish about the blood.He went on to become a very famous and successful doctor.He had a severe dislike for rats and all other kinds of rodents. find the slope of the line passing through the points (-5,5) and (-5,-8) What is the unit rate of 232 people in 8 classrooms? i need help with this pleasee five men build a wall in 10 days how long will it take 10 men Anchara drops a penny from a height of 60 feet above the ground. The equation h=-16t^2 + 60 models the penbys height h i feet as a function of time t in seconds whatvare the solutions P3- is a(n) ______________________, so it ________________ valence electrons. Group of answ er choices anion, gained cation, gained cation, lost anion, lost The following DNA is being replicated and the origin of replication is in the middle of the sequence and marked with three stars ***. 5'ATCGGGCTACCCATGAAATGCTAGCATT***TAAGATCTTAAGCTAGCTAGTTCGATCTGA3'What is the sequence of the primer for the LEADING strand? Your answer should be 8 nucleotides long, written from 5' to 3' and only include the nucleic acid sequence (ex: ACTACTAC).note: there are two answers for this question A farmer's market is selling peaches for $2.00 a pound. If you buy 2 pounds, you save 10% on each pound. How much does it cost to get 2 pounds of peaches? 1. What right do education encompasses both entitlements and freedom?A. Right to free and compulsory primary educationB. Right the quality education in private schoolC. Right to choose yourteachersD. All of the above2. Which of the following is an example of non-formal education?A. Primary schoolingB. Senior high schoolC. Adult night classesD. Doctorate program El libro. _____ Libros. Approximately how many people are likely trafficked into the United States each year?5,5008,5008,50011,50011,500-14,500O 14,50017,500 She dove 75 feet under the sea